ID: 903682064

View in Genome Browser
Species Human (GRCh38)
Location 1:25103703-25103725
Sequence CCCCGTGAGCAGAGAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903682064_903682068 1 Left 903682064 1:25103703-25103725 CCAGCTGCTCTCTGCTCACGGGG No data
Right 903682068 1:25103727-25103749 ACGGGACGTCAAGATGAGCCAGG No data
903682064_903682069 2 Left 903682064 1:25103703-25103725 CCAGCTGCTCTCTGCTCACGGGG No data
Right 903682069 1:25103728-25103750 CGGGACGTCAAGATGAGCCAGGG No data
903682064_903682074 26 Left 903682064 1:25103703-25103725 CCAGCTGCTCTCTGCTCACGGGG No data
Right 903682074 1:25103752-25103774 GGTCCCCCTCCCTGCATGAGGGG No data
903682064_903682070 5 Left 903682064 1:25103703-25103725 CCAGCTGCTCTCTGCTCACGGGG No data
Right 903682070 1:25103731-25103753 GACGTCAAGATGAGCCAGGGTGG No data
903682064_903682073 25 Left 903682064 1:25103703-25103725 CCAGCTGCTCTCTGCTCACGGGG No data
Right 903682073 1:25103751-25103773 TGGTCCCCCTCCCTGCATGAGGG No data
903682064_903682072 24 Left 903682064 1:25103703-25103725 CCAGCTGCTCTCTGCTCACGGGG No data
Right 903682072 1:25103750-25103772 GTGGTCCCCCTCCCTGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903682064 Original CRISPR CCCCGTGAGCAGAGAGCAGC TGG (reversed) Intergenic
No off target data available for this crispr