ID: 903682740

View in Genome Browser
Species Human (GRCh38)
Location 1:25108005-25108027
Sequence CCCAATCATAGCCCTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903682740_903682750 29 Left 903682740 1:25108005-25108027 CCAGCTGCAGGGCTATGATTGGG No data
Right 903682750 1:25108057-25108079 CAGGTGATGGGACTTGTCTTTGG No data
903682740_903682747 10 Left 903682740 1:25108005-25108027 CCAGCTGCAGGGCTATGATTGGG No data
Right 903682747 1:25108038-25108060 ATAAGGTGTGAAACGGGTTCAGG No data
903682740_903682744 -7 Left 903682740 1:25108005-25108027 CCAGCTGCAGGGCTATGATTGGG No data
Right 903682744 1:25108021-25108043 GATTGGGGCATGGACTGATAAGG No data
903682740_903682749 17 Left 903682740 1:25108005-25108027 CCAGCTGCAGGGCTATGATTGGG No data
Right 903682749 1:25108045-25108067 GTGAAACGGGTTCAGGTGATGGG No data
903682740_903682745 3 Left 903682740 1:25108005-25108027 CCAGCTGCAGGGCTATGATTGGG No data
Right 903682745 1:25108031-25108053 TGGACTGATAAGGTGTGAAACGG No data
903682740_903682746 4 Left 903682740 1:25108005-25108027 CCAGCTGCAGGGCTATGATTGGG No data
Right 903682746 1:25108032-25108054 GGACTGATAAGGTGTGAAACGGG No data
903682740_903682748 16 Left 903682740 1:25108005-25108027 CCAGCTGCAGGGCTATGATTGGG No data
Right 903682748 1:25108044-25108066 TGTGAAACGGGTTCAGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903682740 Original CRISPR CCCAATCATAGCCCTGCAGC TGG (reversed) Intergenic
No off target data available for this crispr