ID: 903682750

View in Genome Browser
Species Human (GRCh38)
Location 1:25108057-25108079
Sequence CAGGTGATGGGACTTGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903682740_903682750 29 Left 903682740 1:25108005-25108027 CCAGCTGCAGGGCTATGATTGGG No data
Right 903682750 1:25108057-25108079 CAGGTGATGGGACTTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903682750 Original CRISPR CAGGTGATGGGACTTGTCTT TGG Intergenic
No off target data available for this crispr