ID: 903683872

View in Genome Browser
Species Human (GRCh38)
Location 1:25116787-25116809
Sequence ACGTGGGCTCCTGGAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903683872_903683881 3 Left 903683872 1:25116787-25116809 CCAGGCCCTCCAGGAGCCCACGT No data
Right 903683881 1:25116813-25116835 GACTGGCTTAGGTGGAGCTTAGG No data
903683872_903683877 -8 Left 903683872 1:25116787-25116809 CCAGGCCCTCCAGGAGCCCACGT No data
Right 903683877 1:25116802-25116824 GCCCACGTGCAGACTGGCTTAGG No data
903683872_903683880 -5 Left 903683872 1:25116787-25116809 CCAGGCCCTCCAGGAGCCCACGT No data
Right 903683880 1:25116805-25116827 CACGTGCAGACTGGCTTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903683872 Original CRISPR ACGTGGGCTCCTGGAGGGCC TGG (reversed) Intergenic
No off target data available for this crispr