ID: 903685976

View in Genome Browser
Species Human (GRCh38)
Location 1:25132299-25132321
Sequence TAGGGTCAATGCAGGATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903685976_903685982 15 Left 903685976 1:25132299-25132321 CCATTCATCCTGCATTGACCCTA No data
Right 903685982 1:25132337-25132359 TGCTTCCCTGTGTCCATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903685976 Original CRISPR TAGGGTCAATGCAGGATGAA TGG (reversed) Intergenic
No off target data available for this crispr