ID: 903686147

View in Genome Browser
Species Human (GRCh38)
Location 1:25133474-25133496
Sequence CACACAAACCTGTCTACATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903686147_903686149 -6 Left 903686147 1:25133474-25133496 CCCAATGTAGACAGGTTTGTGTG No data
Right 903686149 1:25133491-25133513 TGTGTGAGAAGATGAAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903686147 Original CRISPR CACACAAACCTGTCTACATT GGG (reversed) Intergenic
No off target data available for this crispr