ID: 903690694

View in Genome Browser
Species Human (GRCh38)
Location 1:25171384-25171406
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903690694_903690697 8 Left 903690694 1:25171384-25171406 CCAGGGTCCCTTTGCTCACTCTG No data
Right 903690697 1:25171415-25171437 TCATTGTTCAATATTCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903690694 Original CRISPR CAGAGTGAGCAAAGGGACCC TGG (reversed) Intergenic
No off target data available for this crispr