ID: 903693709

View in Genome Browser
Species Human (GRCh38)
Location 1:25192529-25192551
Sequence CACCCCAGTGTGGAAGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903693701_903693709 13 Left 903693701 1:25192493-25192515 CCAGAACAGGACTCACTGCTCCA No data
Right 903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG No data
903693699_903693709 15 Left 903693699 1:25192491-25192513 CCCCAGAACAGGACTCACTGCTC No data
Right 903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG No data
903693695_903693709 26 Left 903693695 1:25192480-25192502 CCTTCCCACTGCCCCAGAACAGG No data
Right 903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG No data
903693693_903693709 28 Left 903693693 1:25192478-25192500 CCCCTTCCCACTGCCCCAGAACA No data
Right 903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG No data
903693698_903693709 21 Left 903693698 1:25192485-25192507 CCACTGCCCCAGAACAGGACTCA No data
Right 903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG No data
903693694_903693709 27 Left 903693694 1:25192479-25192501 CCCTTCCCACTGCCCCAGAACAG No data
Right 903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG No data
903693700_903693709 14 Left 903693700 1:25192492-25192514 CCCAGAACAGGACTCACTGCTCC No data
Right 903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG No data
903693697_903693709 22 Left 903693697 1:25192484-25192506 CCCACTGCCCCAGAACAGGACTC No data
Right 903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG No data
903693704_903693709 -7 Left 903693704 1:25192513-25192535 CCACACAGGGTTCCACCACCCCA No data
Right 903693709 1:25192529-25192551 CACCCCAGTGTGGAAGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903693709 Original CRISPR CACCCCAGTGTGGAAGGCGC AGG Intergenic
No off target data available for this crispr