ID: 903694064

View in Genome Browser
Species Human (GRCh38)
Location 1:25194692-25194714
Sequence CGCGGCTGCCGCAGCCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903694064_903694070 24 Left 903694064 1:25194692-25194714 CCCCCAGGGCTGCGGCAGCCGCG No data
Right 903694070 1:25194739-25194761 GTGAGAAACGCAGGAGCGACAGG No data
903694064_903694071 28 Left 903694064 1:25194692-25194714 CCCCCAGGGCTGCGGCAGCCGCG No data
Right 903694071 1:25194743-25194765 GAAACGCAGGAGCGACAGGCCGG No data
903694064_903694069 15 Left 903694064 1:25194692-25194714 CCCCCAGGGCTGCGGCAGCCGCG No data
Right 903694069 1:25194730-25194752 CTGCAGTCAGTGAGAAACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903694064 Original CRISPR CGCGGCTGCCGCAGCCCTGG GGG (reversed) Intergenic