ID: 903700839

View in Genome Browser
Species Human (GRCh38)
Location 1:25247214-25247236
Sequence CGTTCCCCAAACGCGGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 69}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903700826_903700839 29 Left 903700826 1:25247162-25247184 CCTAGAAACCCCGCTCGGCGCCC 0: 1
1: 0
2: 2
3: 9
4: 68
Right 903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 69
903700832_903700839 9 Left 903700832 1:25247182-25247204 CCCTGAGGCCGCGGCCTTGAAGC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 69
903700825_903700839 30 Left 903700825 1:25247161-25247183 CCCTAGAAACCCCGCTCGGCGCC 0: 1
1: 0
2: 0
3: 1
4: 27
Right 903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 69
903700828_903700839 21 Left 903700828 1:25247170-25247192 CCCCGCTCGGCGCCCTGAGGCCG 0: 1
1: 0
2: 1
3: 12
4: 143
Right 903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 69
903700830_903700839 19 Left 903700830 1:25247172-25247194 CCGCTCGGCGCCCTGAGGCCGCG 0: 1
1: 0
2: 0
3: 15
4: 133
Right 903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 69
903700834_903700839 1 Left 903700834 1:25247190-25247212 CCGCGGCCTTGAAGCGAAACGCT 0: 1
1: 0
2: 0
3: 4
4: 37
Right 903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 69
903700829_903700839 20 Left 903700829 1:25247171-25247193 CCCGCTCGGCGCCCTGAGGCCGC 0: 1
1: 0
2: 2
3: 19
4: 175
Right 903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 69
903700835_903700839 -5 Left 903700835 1:25247196-25247218 CCTTGAAGCGAAACGCTGCGTTC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 69
903700833_903700839 8 Left 903700833 1:25247183-25247205 CCTGAGGCCGCGGCCTTGAAGCG 0: 1
1: 0
2: 0
3: 3
4: 59
Right 903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903700839 Original CRISPR CGTTCCCCAAACGCGGGGCC CGG Intronic
901714277 1:11140522-11140544 GGGTCCCCAGACCCGGGGCCGGG - Intronic
903700839 1:25247214-25247236 CGTTCCCCAAACGCGGGGCCCGG + Intronic
905474783 1:38218335-38218357 GCTTCTCCAAACTCGGGGCCTGG - Intergenic
905734648 1:40316885-40316907 CCGTCCCCAGACGCGCGGCCCGG - Intronic
906066578 1:42985262-42985284 CCTTCCCAAGACACGGGGCCTGG + Intergenic
910467865 1:87519275-87519297 CTTTCCCAAAATGCGGGGGCAGG + Intergenic
911219801 1:95234409-95234431 CGGTCCCCATACGTGGGCCCAGG - Intronic
1067216194 10:44306160-44306182 CCTTCCCCAACCACTGGGCCTGG + Intergenic
1073268364 10:102241645-102241667 CCTCCCTCAAAGGCGGGGCCTGG - Intergenic
1086981047 11:93197962-93197984 CGCTCCCCAACCGCGCGGCGAGG + Exonic
1090078028 11:123591684-123591706 CCACCCCCAAAGGCGGGGCCTGG - Intronic
1097263979 12:57735692-57735714 ACATCCCCAAACGCGGGTCCTGG + Intronic
1104900573 12:132187769-132187791 GATTCACCAAACCCGGGGCCCGG + Intergenic
1105941617 13:25152867-25152889 GGTTCCCCAAAAGCATGGCCAGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1115787560 14:36843175-36843197 GGGTCCCCAAACCCTGGGCCAGG - Intronic
1121690825 14:95876322-95876344 GGCTCCGCAGACGCGGGGCCGGG + Intergenic
1202904345 14_GL000194v1_random:59829-59851 AGTCCCCCAAACCTGGGGCCAGG + Intergenic
1130301068 15:82680256-82680278 CTTGCCCCAACCGAGGGGCCCGG - Intronic
1132141714 15:99402591-99402613 CGTCCCCCAGACGTGCGGCCAGG + Intergenic
1132937001 16:2486279-2486301 CGTTCCCCACCCATGGGGCCCGG + Intronic
1137352537 16:47726196-47726218 CATTCCCCAAACAGTGGGCCAGG - Intergenic
1141499228 16:84432062-84432084 CGCTCCCCCAACTCGGGGCTGGG + Intronic
1142142582 16:88479173-88479195 CGAGTCCCAACCGCGGGGCCGGG + Intronic
1147137620 17:38443401-38443423 CTGTCCCCAAATGTGGGGCCAGG + Intronic
1152923821 17:83078929-83078951 CGCTCCGGATACGCGGGGCCGGG - Intergenic
1156478366 18:37420662-37420684 CGTTCTCCAAGCATGGGGCCTGG + Intronic
1160767007 19:813185-813207 TGTCCCCCAAAAGCGGCGCCGGG - Exonic
1161074059 19:2276447-2276469 CGTGCCCCACCCGTGGGGCCTGG - Exonic
1163646665 19:18493443-18493465 GGCTCCCCAAATGCAGGGCCTGG + Intronic
1164618447 19:29680306-29680328 TGTTCCCTAAACCCTGGGCCAGG - Intergenic
926684868 2:15690841-15690863 CGTTCCTCAAACGCGAGGTGGGG - Intronic
933057043 2:77683394-77683416 CGGTCCCCAACCCCTGGGCCAGG - Intergenic
933886157 2:86720559-86720581 CGTTCCCCAAGCGGGCGGCGCGG - Exonic
933924024 2:87076147-87076169 CGTTCCCCAAGCGGGCGGCGCGG + Intergenic
933927175 2:87104537-87104559 CGGTCCCCAACCCCTGGGCCAGG - Intergenic
935515081 2:104026645-104026667 CTTTCACCAAAGGCAGGGCCCGG + Intergenic
940883377 2:158968730-158968752 GGTTCCCCACACCCAGGGCCGGG - Exonic
947049857 2:226030483-226030505 CGTTCCCCAAAGGGGGGGGGGGG + Intergenic
947287188 2:228530010-228530032 GGATCCCCAAACCCTGGGCCAGG + Intergenic
1171433805 20:25104098-25104120 CCTTCCCCAACCGCAGGGCTGGG + Intergenic
1171892394 20:30728414-30728436 CCTACCCCAGACGCGGGACCTGG + Intergenic
1172153995 20:32810858-32810880 CCCTCCCCAAACCCTGGGCCAGG - Intergenic
1174203225 20:48821455-48821477 CATTCCCCAGACATGGGGCCAGG - Intronic
1175798104 20:61785058-61785080 TGCTCCCCAAAGGCGGGGTCAGG + Intronic
1176296731 21:5076952-5076974 CGTTCCCAAAGGGCAGGGCCTGG + Intergenic
1176385213 21:6135635-6135657 CGTTCCCCAGACGCAAGGCTGGG + Intergenic
1176623713 21:9074596-9074618 CATCCCCCAAACCTGGGGCCAGG + Intergenic
1179738260 21:43402617-43402639 CGTTCCCCAGACGCAAGGCTGGG - Intergenic
1179860318 21:44185169-44185191 CGTTCCCAAAGGGCAGGGCCTGG - Intergenic
1184059785 22:42074651-42074673 CCTTCCCCAGACGCGGGGGAGGG + Intronic
955910944 3:63859670-63859692 CTTTCCCCAAAGCAGGGGCCAGG + Intronic
968501146 4:950658-950680 CTTACCCCAAACCCAGGGCCTGG + Intronic
984907922 4:184647784-184647806 CTTGCCCCAAATGCGGGGCCTGG - Intronic
984922980 4:184782043-184782065 TGTTCCCCATAGGCAGGGCCAGG - Intronic
986741872 5:10711874-10711896 CCTTCCTCAAACGCAGGACCAGG + Intronic
992609507 5:78495094-78495116 CCTTCCCCAAACTGGGGGACTGG - Intronic
996948187 5:129094795-129094817 CGCTCCCCAACAGCGGCGCCGGG + Exonic
998018787 5:138753250-138753272 CTTTCCCCAAAAGCGGAGGCCGG + Intronic
1018841788 6:167522669-167522691 TGCTCCCCAAAGCCGGGGCCAGG - Intergenic
1019473923 7:1235192-1235214 CTTTCCGCAAACCCTGGGCCAGG - Intronic
1020211263 7:6159650-6159672 CTGTCCCCAAGCGCGTGGCCTGG - Intronic
1024639116 7:51316049-51316071 CCTTCCGAGAACGCGGGGCCCGG + Intronic
1029212073 7:98917365-98917387 CGCTCCCCAGACTCGGGCCCAGG - Intronic
1029367777 7:100127536-100127558 CCTACCCCAGACCCGGGGCCCGG + Exonic
1042874054 8:73424494-73424516 CGTTCACAAAAAGAGGGGCCGGG - Intronic
1044319976 8:90791312-90791334 CCTTCCCCAAAGGCGGGGGCAGG - Intronic
1059107633 9:111525275-111525297 CGGCCCCGAAACTCGGGGCCCGG - Intronic
1061716719 9:132522857-132522879 CGGTCCCCAGACTCGGGGTCAGG - Intronic
1203746899 Un_GL000218v1:45024-45046 CGTCCCCCAAACCTGGGGCCAGG + Intergenic
1203561759 Un_KI270744v1:63934-63956 CCTACCCCAGACGCGGGACCTGG + Intergenic
1203563207 Un_KI270744v1:74456-74478 AGTCCCCCAAACCTGGGGCCAGG - Intergenic
1201160224 Y:11160038-11160060 CATCCCCCAAACCTGGGGCCAGG + Intergenic