ID: 903705113

View in Genome Browser
Species Human (GRCh38)
Location 1:25279986-25280008
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903705102_903705113 14 Left 903705102 1:25279949-25279971 CCAGTGAGGATGCTCCAAGCTGG 0: 2
1: 0
2: 1
3: 7
4: 171
Right 903705113 1:25279986-25280008 GCGGGAGCCCAGATAATGGATGG 0: 2
1: 0
2: 1
3: 4
4: 104
903705105_903705113 0 Left 903705105 1:25279963-25279985 CCAAGCTGGGACCCAGCCCTGAA 0: 2
1: 0
2: 5
3: 30
4: 281
Right 903705113 1:25279986-25280008 GCGGGAGCCCAGATAATGGATGG 0: 2
1: 0
2: 1
3: 4
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902623104 1:17661771-17661793 GCTGGAGCCAAGAAAATGCAAGG - Intronic
902927612 1:19707113-19707135 GCTGGAGCACAGAGAATGAAGGG - Intronic
903705113 1:25279986-25280008 GCGGGAGCCCAGATAATGGATGG + Intronic
903722112 1:25413335-25413357 GCGGGAGCCCAGATAATGGACGG - Intronic
905813284 1:40928824-40928846 GCTGGATCCCAGATAAGGCATGG + Intergenic
905935509 1:41821067-41821089 GCTGGAGCCCAGAGAAGGAAAGG + Intronic
907080888 1:51620707-51620729 GCAGGAGGACAGATAATGAAAGG + Intronic
914813995 1:151049633-151049655 GCTTGAGCCCAGAAGATGGAGGG - Intronic
915343275 1:155187650-155187672 GCGGGGACCCAGACACTGGAAGG + Intronic
916082172 1:161240937-161240959 GCTGGAGCTAAGATAGTGGAAGG + Intergenic
917095826 1:171397988-171398010 GCAGGAGACAAGATAATGGTCGG - Intergenic
921122501 1:212149112-212149134 GCGGGAGCCTCAAAAATGGATGG + Intergenic
1064604597 10:17025896-17025918 GCGGGAGGACAGATCATGCAGGG + Intronic
1067576030 10:47409222-47409244 GCCAGAGCCCAGCTACTGGAGGG - Intergenic
1072312718 10:94171905-94171927 GAGGGAGTCCTAATAATGGAAGG - Intronic
1075155256 10:119970978-119971000 GAGGGAGAACAGATAATGAAAGG - Intergenic
1076379870 10:130017621-130017643 GCAGGAGCCCAGGTGATGGGGGG - Intergenic
1077900642 11:6484951-6484973 GAGGAAGACCAGATTATGGAAGG - Intronic
1079015718 11:16867055-16867077 ACTGCAGCCCAGAGAATGGATGG + Intronic
1080735353 11:35008794-35008816 GGGGGAGTCCAAACAATGGATGG - Intronic
1083180441 11:60981732-60981754 GCAGGAGCCTACAAAATGGAGGG - Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1091386005 12:95004-95026 GCAAGAGCCCAGACAATGCAGGG - Intronic
1094108375 12:26836244-26836266 GAAGGAGACCAGATCATGGATGG - Intergenic
1095909272 12:47409381-47409403 GAGGGAGGTCAGATCATGGAGGG - Intergenic
1096671187 12:53199143-53199165 GTGGGAGCCCAGATAAGAGATGG - Intronic
1099019251 12:77382598-77382620 GAGGGAGCCGAGAGAATGAATGG - Intergenic
1109879619 13:68453780-68453802 GCTGGAGCATATATAATGGAAGG + Intergenic
1113062083 13:106332774-106332796 GCGGAAGCCCAGACAGTGTATGG - Intergenic
1113659432 13:112095541-112095563 GAGGGGGCCCTGATGATGGAGGG - Intergenic
1114590455 14:23860004-23860026 GAGGGAGCCCAGAAAATGGAGGG - Intergenic
1120173962 14:81274012-81274034 CCGGGAACCCAGAGAATTGATGG - Intronic
1122960696 14:105092567-105092589 CCAGGAGTCCAGATAAAGGAGGG + Intergenic
1123043313 14:105499420-105499442 GCGGGAGCCCAAATGAAGGGGGG - Intronic
1129719516 15:77870488-77870510 GCGGATGCCCAGAGAAAGGAGGG - Intergenic
1130060905 15:80569305-80569327 GTTGTAGCCCAGCTAATGGAGGG + Intronic
1131050804 15:89346641-89346663 GCAGTAGCTCAGATAATGGCAGG + Intergenic
1134800520 16:17080206-17080228 GCCACAGCCAAGATAATGGAAGG - Intergenic
1136713661 16:32259888-32259910 GCAGGAGCCCTGGCAATGGAGGG - Intergenic
1136754251 16:32669543-32669565 GCAGGAGCCCTGGCAATGGAGGG + Intergenic
1136813862 16:33200822-33200844 GCAGGAGCCCTGGCAATGGAGGG - Intronic
1136820338 16:33310902-33310924 GCAGGAGCCCTGGCAATGGAGGG - Intergenic
1136826901 16:33367441-33367463 GCAGGAGCCCTGGCAATGGAGGG - Intergenic
1136831967 16:33466212-33466234 GCAGGAGCCCTGGCAATGGAGGG - Intergenic
1136997469 16:35200742-35200764 GCAGGAGCCCTGGCAATGGAGGG + Intergenic
1139506398 16:67400140-67400162 GCGGGTGCCCAGTGAATGGCAGG + Intronic
1139967684 16:70754726-70754748 GCCTCAGCCCAGAGAATGGAGGG - Intronic
1202992438 16_KI270728v1_random:23796-23818 GCAGGAGCCCTGGCAATGGAGGG - Intergenic
1203056397 16_KI270728v1_random:929874-929896 GCAGGAGCCCTGGCAATGGAGGG + Intergenic
1143916981 17:10301464-10301486 GTGGGAGGCCAGATAAGGGCAGG - Intronic
1144005274 17:11094072-11094094 GCAGGAGATCAGATAACGGAAGG - Intergenic
1144486102 17:15665557-15665579 TCGGGAAACCAGATAATGAATGG + Intronic
1144740872 17:17581557-17581579 GTGGGAGCCAAGATGAAGGACGG + Intronic
1144914922 17:18716739-18716761 TCGGGAAACCAGATAATGAATGG - Intronic
1147272948 17:39289561-39289583 GTGGGAGCCCAGGAGATGGAGGG + Intronic
1147557688 17:41489754-41489776 GCAGGAGCCCACAGAACGGATGG + Exonic
1152072015 17:78138678-78138700 GTGGGAGCCCAGGTAGTGGAGGG - Exonic
1157442569 18:47721942-47721964 GAGGGAGAGCCGATAATGGATGG - Intergenic
1158373972 18:56841993-56842015 TCAGGAGCCTAGATTATGGAAGG + Intronic
1160770487 19:828724-828746 GAGGGGGCCCAGAGAAAGGAAGG + Intronic
1160770643 19:829219-829241 GGGGAGGCCCAGATAAGGGAAGG + Intronic
1162524931 19:11201604-11201626 GAGGGAGCCCAGATCTAGGAAGG - Intronic
1163700575 19:18784748-18784770 GCGGGAGCCCAGAGGAGGGCTGG + Intronic
930527821 2:52552701-52552723 GAGACAGCCCACATAATGGAAGG + Intergenic
937953393 2:127405514-127405536 GTGGGGGCCCAGATAATGTCAGG + Intergenic
938723533 2:134087025-134087047 GCGGGAGACCAGATAGTCAAAGG - Intergenic
940052865 2:149482565-149482587 ATGGGAGCTCAGAGAATGGAAGG - Intergenic
945724994 2:213464653-213464675 GCTGGAGCCCAAAGAATGGGAGG - Intronic
948640451 2:239372461-239372483 GCGGGAGCCCAGCCCAAGGAAGG - Intronic
1172516599 20:35538628-35538650 TCTGAAGCCCAGATAATAGAGGG + Intergenic
1178882944 21:36463024-36463046 GGGGGAGCACAGAGAAAGGAAGG + Intronic
1179475303 21:41639435-41639457 CCGGGAGCACAGATCACGGAGGG + Intergenic
1183475642 22:38034414-38034436 GCTGGAGCCCAGAGAAGGGTTGG - Intronic
1184940240 22:47759692-47759714 GTGGGAGCCCATAGGATGGAGGG + Intergenic
1185322577 22:50208825-50208847 GCGGGAGCTCAGAGAAGGGCGGG - Intronic
952410265 3:33042682-33042704 GCTGGAGCCCAGTAAATGAAGGG - Intronic
952509440 3:34038600-34038622 GCAGGAGACCAGAGACTGGAGGG + Intergenic
952702474 3:36341506-36341528 GCTGGGGACCAGATAATGGCTGG + Intergenic
953086336 3:39671676-39671698 GAGGGAGAACAGATAAGGGAGGG - Intergenic
961102795 3:124215866-124215888 GCTGGAGCCTGGATAATGGCAGG - Intronic
964336322 3:155658435-155658457 GCGGAAGCCCAGACACGGGAAGG + Intronic
964614554 3:158648743-158648765 GGGGAAGAACAGATAATGGAGGG - Intronic
972852000 4:43061914-43061936 GCTGGAGCCCAGGTATTTGAGGG - Intergenic
973935264 4:55840020-55840042 GCAGGAGCCCAGGAAGTGGAGGG + Intergenic
976604615 4:86970934-86970956 GCAGGAGGCCAGATTGTGGAGGG + Intronic
981028775 4:140102750-140102772 GGGGGACCACAGATAATGGCAGG - Intronic
986751516 5:10792167-10792189 GCTGAAGCCCAGAGCATGGATGG - Intergenic
988075305 5:26344888-26344910 GTGAGAGGACAGATAATGGATGG - Intergenic
996164473 5:120208417-120208439 TCTGGAGCTCAGAAAATGGATGG + Intergenic
998642229 5:144023903-144023925 GCTTGAACCCAGAGAATGGATGG - Intergenic
1000088917 5:157912840-157912862 GCAGGGTCCCAGAGAATGGAAGG + Intergenic
1012643387 6:101650616-101650638 GAGGGAGGGCAGATAATGGGAGG - Intronic
1014515702 6:122375811-122375833 GAGGGAGCAGAGATAATAGAGGG + Intergenic
1032547304 7:132754660-132754682 GTGGGAGCCCATATAGTTGATGG - Intergenic
1033319351 7:140325908-140325930 GCTGGATTCCAGATGATGGAAGG + Intronic
1036520613 8:9488289-9488311 TCAGCAGCCCAGATCATGGATGG + Intergenic
1038355770 8:26827974-26827996 GCTGGAGCCCAGAAAGTTGAGGG - Intronic
1040439223 8:47423706-47423728 AGGGGAGCCCAGATCATGCAGGG + Intronic
1042142631 8:65694809-65694831 GTGGGAGCCAAGTAAATGGAAGG + Intronic
1043564620 8:81534300-81534322 GCTGCAGCCCATATACTGGATGG - Intergenic
1045707883 8:104947762-104947784 GCTGGAGGGCAGATGATGGAAGG - Intronic
1053014295 9:34653377-34653399 GCTGGGGCCCAAAGAATGGAGGG + Intronic
1055697545 9:78903005-78903027 GCAGGAGGCCAGATGATGGAGGG + Intergenic
1057954970 9:99400279-99400301 GCTGGGGCCCAGAGAATGGAAGG - Intergenic
1058815863 9:108682201-108682223 GAGGGAGACCAGAGAATGTAAGG + Intergenic
1061669716 9:132182041-132182063 CCGGCAGCCCAGAGAAGGGAGGG + Intronic
1190726716 X:53194782-53194804 GGGGGGGCCCAGAGAAGGGAAGG - Intronic
1194706786 X:97184947-97184969 GCAGGAGCCCAGACAAAGTAAGG - Intronic
1196764975 X:119235390-119235412 GCTGGAGCCCAGACAAAGGCGGG - Intergenic
1199600503 X:149538899-149538921 GCGGGAGACTAGATAAGGGGAGG + Intergenic
1199650085 X:149941042-149941064 GCGGGAGACTAGATAAGGGGAGG - Intergenic