ID: 903707609

View in Genome Browser
Species Human (GRCh38)
Location 1:25298423-25298445
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 2, 1: 0, 2: 2, 3: 16, 4: 328}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903707609_903707612 -8 Left 903707609 1:25298423-25298445 CCTCAAAACTTCAATTCAGCCTG 0: 2
1: 0
2: 2
3: 16
4: 328
Right 903707612 1:25298438-25298460 TCAGCCTGGGTTTCTTCAGCAGG 0: 2
1: 1
2: 3
3: 35
4: 288
903707609_903707617 2 Left 903707609 1:25298423-25298445 CCTCAAAACTTCAATTCAGCCTG 0: 2
1: 0
2: 2
3: 16
4: 328
Right 903707617 1:25298448-25298470 TTTCTTCAGCAGGAGGGCCCGGG 0: 1
1: 1
2: 2
3: 27
4: 239
903707609_903707621 18 Left 903707609 1:25298423-25298445 CCTCAAAACTTCAATTCAGCCTG 0: 2
1: 0
2: 2
3: 16
4: 328
Right 903707621 1:25298464-25298486 GCCCGGGGGAACCAGAGCCAGGG 0: 1
1: 1
2: 2
3: 13
4: 197
903707609_903707615 -4 Left 903707609 1:25298423-25298445 CCTCAAAACTTCAATTCAGCCTG 0: 2
1: 0
2: 2
3: 16
4: 328
Right 903707615 1:25298442-25298464 CCTGGGTTTCTTCAGCAGGAGGG 0: 2
1: 0
2: 3
3: 36
4: 233
903707609_903707619 4 Left 903707609 1:25298423-25298445 CCTCAAAACTTCAATTCAGCCTG 0: 2
1: 0
2: 2
3: 16
4: 328
Right 903707619 1:25298450-25298472 TCTTCAGCAGGAGGGCCCGGGGG 0: 1
1: 1
2: 2
3: 12
4: 168
903707609_903707618 3 Left 903707609 1:25298423-25298445 CCTCAAAACTTCAATTCAGCCTG 0: 2
1: 0
2: 2
3: 16
4: 328
Right 903707618 1:25298449-25298471 TTCTTCAGCAGGAGGGCCCGGGG 0: 1
1: 1
2: 0
3: 17
4: 174
903707609_903707616 1 Left 903707609 1:25298423-25298445 CCTCAAAACTTCAATTCAGCCTG 0: 2
1: 0
2: 2
3: 16
4: 328
Right 903707616 1:25298447-25298469 GTTTCTTCAGCAGGAGGGCCCGG 0: 1
1: 1
2: 2
3: 16
4: 270
903707609_903707613 -5 Left 903707609 1:25298423-25298445 CCTCAAAACTTCAATTCAGCCTG 0: 2
1: 0
2: 2
3: 16
4: 328
Right 903707613 1:25298441-25298463 GCCTGGGTTTCTTCAGCAGGAGG 0: 2
1: 0
2: 1
3: 26
4: 288
903707609_903707620 17 Left 903707609 1:25298423-25298445 CCTCAAAACTTCAATTCAGCCTG 0: 2
1: 0
2: 2
3: 16
4: 328
Right 903707620 1:25298463-25298485 GGCCCGGGGGAACCAGAGCCAGG 0: 1
1: 1
2: 1
3: 24
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903707609 Original CRISPR CAGGCTGAATTGAAGTTTTG AGG (reversed) Intronic
900813483 1:4825896-4825918 CAGGCTGAACCCAAATTTTGGGG + Intergenic
901266958 1:7918421-7918443 CAGGCTGAAGTGTAGTGATGCGG + Exonic
903429488 1:23282542-23282564 AATGCTGAATGGAACTTTTGAGG + Intergenic
903707609 1:25298423-25298445 CAGGCTGAATTGAAGTTTTGAGG - Intronic
903719632 1:25394931-25394953 CAGGCTGAATTGAAGTTTTGAGG + Intronic
905219811 1:36437467-36437489 GAGGCAGAATTAAAGTTTTGGGG + Intronic
905795293 1:40812650-40812672 CAGGGAGAAGTGAAGTTTGGGGG + Intronic
908522750 1:64960181-64960203 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
908643960 1:66256521-66256543 CAGATTAAATTGAAGTTTGGAGG + Intronic
908948841 1:69534975-69534997 CAGAATCAATTGAAGTTTTAAGG - Intergenic
909659600 1:78067494-78067516 CAGGCTGAAGTGTAGTGTCGTGG + Intronic
910175605 1:84427121-84427143 CAGGCTGGAGTGCAGTGTTGCGG - Intergenic
911632485 1:100199073-100199095 CCAGCTGAATTGGAATTTTGGGG - Intronic
913662688 1:121018698-121018720 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
914014071 1:143801958-143801980 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
914163750 1:145159242-145159264 CAGGCTGGAGTGCAGTTGTGTGG + Intergenic
914379050 1:147100080-147100102 CAGGCTGACTGGAAGTTCTGGGG - Intergenic
914652689 1:149710513-149710535 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
916619174 1:166477174-166477196 CATGTTGAATTGGAATTTTGGGG - Intergenic
917363152 1:174199334-174199356 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
917467655 1:175296519-175296541 CAGGCTGAAGTGCAGTGGTGCGG + Intergenic
918920508 1:190703800-190703822 ATGGCTGAATTACAGTTTTGAGG - Intergenic
919588328 1:199467075-199467097 CAGGCTGAAATGTATATTTGAGG + Intergenic
920338307 1:205259532-205259554 CAGGCTTAAGTGAAGCTGTGTGG - Intronic
922371406 1:224913738-224913760 CAGGCTGGAGTGCAGTGTTGTGG - Intronic
922555972 1:226532251-226532273 CAGGCTGGAGTGTAGTTGTGCGG + Intergenic
922914594 1:229246058-229246080 CAGGCTGAAGTGCAGTGGTGTGG - Intergenic
923186372 1:231577548-231577570 CAGGCTGGAATGAAGTGGTGTGG + Intronic
924783455 1:247172728-247172750 CACACTGAAGTGCAGTTTTGAGG + Intergenic
1065699340 10:28409839-28409861 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
1070193133 10:74131065-74131087 CAGGCTGTAGTGCAGTGTTGTGG - Intronic
1070715910 10:78720750-78720772 GAGGCTGCATTGGAGCTTTGGGG + Intergenic
1071731480 10:88253032-88253054 TAGGCTGAAGTGAATTTTTCTGG + Intergenic
1073079691 10:100851283-100851305 CACACTGAATTAAAGTTTTCAGG - Intergenic
1073270306 10:102257351-102257373 CAGGCTGGAGTGCAGTTGTGGGG + Intronic
1074692789 10:116021653-116021675 AAGGCTGGATTGTAATTTTGAGG + Intergenic
1077350383 11:2090495-2090517 AAGGCTGAATGGGAGTTTTGTGG - Intergenic
1078222956 11:9366560-9366582 CAGGCTGAAGTGCAGTGGTGCGG + Intergenic
1079999567 11:27332326-27332348 AAGGCTGAATAGAAGCTATGTGG - Intronic
1080435970 11:32244970-32244992 CAGGGTGAGTTGAAATTTTAAGG - Intergenic
1081816763 11:45949168-45949190 CAGGGTGAATTAAAATTTTAAGG + Intronic
1081912737 11:46710560-46710582 CAGCCTGAACTGCAGTGTTGCGG + Intergenic
1082032161 11:47612681-47612703 CAGGCTGGACTGAAGTGTAGTGG - Intergenic
1082838046 11:57666237-57666259 CAGGCTGGAGTGAAGTTGTGTGG + Intergenic
1085183600 11:74556951-74556973 CAGGGTGGATTCAGGTTTTGTGG + Intronic
1085259796 11:75197940-75197962 CAGGCTGTAGTGAAGCTTGGGGG + Intronic
1086901729 11:92375176-92375198 CAGGCTGGAGTGCAGTTGTGGGG + Intronic
1088469456 11:110177531-110177553 GAGGCTGAATGGAGGATTTGGGG - Intronic
1089293460 11:117452973-117452995 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1092114057 12:5985808-5985830 CAGGCTGAAAGGAGGTTGTGAGG + Intronic
1092374907 12:7947377-7947399 CAGGCTGGAGTGCAGTTGTGTGG + Intergenic
1093042732 12:14402651-14402673 CTGGCTGAAGTGAAGTGGTGCGG + Intronic
1093833440 12:23795651-23795673 AATGCTGAATGGGAGTTTTGTGG + Intronic
1093938461 12:25026508-25026530 CAGGGGGGATTGAAGGTTTGTGG + Intronic
1094197624 12:27766012-27766034 AATGCTAAATGGAAGTTTTGAGG - Intronic
1094255682 12:28423272-28423294 CAGGCTAAACTTAACTTTTGAGG + Intronic
1095329655 12:40943257-40943279 TAGTCTGAATTGAAGTCCTGAGG + Intronic
1095973221 12:47919531-47919553 CAGGCTGGAGTGCAGTGTTGCGG - Intronic
1096269093 12:50149777-50149799 TAGGCTGAAGTGAAGTGTGGTGG + Intronic
1098117968 12:67200682-67200704 CAGGCTGAACTGAGGGGTTGGGG + Intergenic
1099510337 12:83527970-83527992 CAGTGTGACTTGAAGTTTGGAGG + Intergenic
1099581660 12:84455425-84455447 CAGGATGAATTGAAGATTAGGGG + Intergenic
1100527081 12:95429802-95429824 CAGGCTGAATTCAAACTCTGGGG - Intergenic
1101577404 12:106010717-106010739 AAGGCTTAATTGATGTTTTAGGG - Intergenic
1101734064 12:107449693-107449715 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1105637863 13:22232771-22232793 CAGGCTGAGTTGAAGTGCAGTGG - Intergenic
1105680492 13:22722427-22722449 CAGGCTGGATTGCAGTGGTGCGG + Intergenic
1106004520 13:25756369-25756391 CAGGCTGGAGTGAAGTGGTGTGG + Intronic
1106046870 13:26150657-26150679 AAGAGTGAATTCAAGTTTTGAGG - Intronic
1106384827 13:29274156-29274178 CAGGCTGGAGTGCAGTGTTGTGG + Intronic
1109185187 13:59259741-59259763 CAGGCTGAATGGATTTTCTGTGG - Intergenic
1110460412 13:75738860-75738882 CAGGCTGACTATAGGTTTTGGGG - Intronic
1110636223 13:77769389-77769411 CAGGATGAATTCAAGTATTTCGG + Intergenic
1111999820 13:95199772-95199794 CAGGGTGAATTGAAAATATGTGG + Intronic
1112558419 13:100490687-100490709 CAGGCAGAAAGGAACTTTTGGGG - Intronic
1115854553 14:37616693-37616715 CAGGCTGGAGTGCAGTGTTGAGG - Intronic
1117732458 14:58737055-58737077 CAGGCTGGAGTGAAGTGGTGTGG + Intergenic
1118256630 14:64211141-64211163 CTGGCTGATTTTAATTTTTGTGG + Intronic
1118510253 14:66464260-66464282 CAGGTTAAGTTGAAATTTTGTGG - Intergenic
1121118700 14:91361934-91361956 CAGCCTGGAGTGTAGTTTTGAGG - Intronic
1121543415 14:94745608-94745630 CAGGCTGGAGTGAAGTGGTGCGG - Intergenic
1121815669 14:96926240-96926262 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1122055515 14:99095580-99095602 CAGGATGAATAGGAGTTTTCAGG + Intergenic
1122179548 14:99945181-99945203 CAGGCTGGAGTGCAGTGTTGTGG - Intergenic
1122229857 14:100300942-100300964 CAGGCTGGAGTGTAGTGTTGCGG + Intronic
1122232850 14:100315651-100315673 CAGGCTGGAGTGTAGTGTTGCGG + Intergenic
1123861093 15:24467461-24467483 CAGGCTGGATTGCAGTGGTGCGG + Intergenic
1125619828 15:41050594-41050616 CAAGCTGAATTGAAGGATTTAGG - Intronic
1127120079 15:55764109-55764131 CAGGTTGATTTGAAGTTTCTTGG - Intergenic
1128409034 15:67375020-67375042 CAGACTGCATGGAAGTTTTTAGG - Intronic
1128956167 15:71947944-71947966 GAGGAAAAATTGAAGTTTTGGGG - Intronic
1130074708 15:80678771-80678793 CAGGCTGAACCGCAGTTTTGGGG - Intergenic
1130646185 15:85729267-85729289 CAGGCTGAAGTGAAGTGCAGTGG - Intronic
1133977553 16:10610567-10610589 CAGGCTGGATTGCAGTGGTGTGG + Intergenic
1134882130 16:17754350-17754372 AAGGCTGAGATCAAGTTTTGGGG - Intergenic
1136596798 16:31256245-31256267 CAGGCTGGAGTGCAGTGTTGAGG + Intergenic
1136784932 16:32928613-32928635 CAGGCTGAAGTGCAGTGGTGTGG - Intergenic
1136884851 16:33925193-33925215 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
1137293539 16:47068678-47068700 CAGGCTGGAGTGCAGTGTTGCGG - Intergenic
1138264545 16:55651150-55651172 CAGGCTGACTCCAAGGTTTGTGG + Intergenic
1139127897 16:64103336-64103358 CAGGCTGGAGTGAAGTAGTGTGG + Intergenic
1139796161 16:69484709-69484731 CAGGCTGGAGTGCAGTGTTGCGG + Intergenic
1139870492 16:70104622-70104644 CAGGCTGAAGTGCAGTGGTGCGG - Intergenic
1140522850 16:75597121-75597143 CAGGTAGACATGAAGTTTTGGGG - Intronic
1140610030 16:76587209-76587231 CAGGCTTAAGTGAAGTTTTGAGG + Intronic
1140953614 16:79842435-79842457 CTGGCTGAATAGCCGTTTTGGGG - Intergenic
1143905294 17:10203556-10203578 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
1144068997 17:11650442-11650464 CAGGCTGCGTTGAACTTCTGTGG - Intronic
1146384805 17:32360463-32360485 CAGTATTAATTGAATTTTTGGGG + Intronic
1147396191 17:40144719-40144741 CAGGCTGGAGTGCAGTTGTGGGG + Intronic
1148272931 17:46277988-46278010 CAGGCTGAAGTGTAGTGGTGTGG + Intronic
1148547304 17:48528117-48528139 CAGGCTGGAGTGCAGTTTTTTGG - Intergenic
1148723473 17:49771875-49771897 CAGGGACAATTGTAGTTTTGAGG - Intronic
1149293046 17:55235617-55235639 CAGGCTGGAGTGAAGTGGTGCGG + Intergenic
1150028020 17:61698757-61698779 CAGGCTGGAGTGAAGTAGTGAGG + Intronic
1151068553 17:71181028-71181050 CAGGCAAAATTGAAGTTGGGTGG - Intergenic
1151375781 17:73687895-73687917 CAGGCTGAAGAGAGGATTTGAGG + Intergenic
1152229088 17:79105791-79105813 CAGGCGGAAGAGAAGTTTGGAGG + Intronic
1153245580 18:3070189-3070211 CAGGCTGAAGTGAAGTGGTATGG + Intronic
1155285532 18:24285013-24285035 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1155972847 18:32098028-32098050 CAGGCTGGATTGCAGTGGTGCGG + Intronic
1156942099 18:42780329-42780351 CAAGCTGAGTTGAAGTCTTCAGG - Intronic
1157207384 18:45712107-45712129 CAGGAGTAATTGAAGTTCTGTGG - Intergenic
1157376923 18:47175828-47175850 CAGGCTGAAGTGCAGTGTCGCGG - Intronic
1157703042 18:49777042-49777064 CAGGCTGGAGTGCAGTTGTGAGG + Intergenic
1159004073 18:62997578-62997600 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
1160049282 18:75417088-75417110 CAGGAAGAATTTAAGTTCTGGGG - Intronic
1160560004 18:79750222-79750244 CAGGCTGGAGTGCAGTGTTGCGG + Intronic
1161023056 19:2020508-2020530 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1161113411 19:2482542-2482564 CAGGCTGAAGTGCAGTGATGTGG + Intergenic
1162656947 19:12138399-12138421 CAGGCTGAATTGAAGTGGCGTGG - Intronic
1163100961 19:15096202-15096224 CAGGCATAATTGAAGGTTGGGGG - Intergenic
1164015369 19:21252124-21252146 CAGGCTGAAATGAAATGGTGTGG - Intronic
1164324328 19:24178778-24178800 CAGGCTGATTTGAAATTTCTGGG - Intergenic
1164401893 19:27908639-27908661 CATGTTGAACTGAAGTGTTGTGG - Intergenic
1165234676 19:34411208-34411230 CAGGCTGAACTGCAGTGGTGTGG + Intronic
1165549323 19:36570314-36570336 CAGGCTGAAATGCAGTGGTGGGG - Intronic
1165646975 19:37448606-37448628 CAGGCTGGAGTGCAGTGTTGTGG + Intronic
1167676465 19:50889501-50889523 AAGGCTGAGTTGAACTTTTCTGG - Intergenic
1168191441 19:54741293-54741315 CAGGCTGGAGTGAAGTGGTGTGG - Intronic
1168195772 19:54772659-54772681 CAGGCTGGAGTGAAGTGGTGTGG - Intronic
1168197666 19:54787511-54787533 CAGGCTGGAGTGAAGTGGTGTGG - Intronic
1168204140 19:54836890-54836912 CAGGCTGGAGTGAAGTGGTGTGG - Intronic
925172139 2:1756642-1756664 CAGGCTGAACTCCAGTTTTGGGG - Intergenic
925227236 2:2194122-2194144 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
929245792 2:39701802-39701824 GAGGCTTAAAAGAAGTTTTGAGG - Intronic
930413864 2:51064270-51064292 CTGGCTGAAATGAGGTTTAGGGG - Intergenic
932372214 2:71200002-71200024 CAGATTGAAATGTAGTTTTGGGG - Intronic
933204783 2:79493569-79493591 CAGGCTGGAGTGCAGTGTTGCGG - Intronic
934136617 2:89001812-89001834 CAGGCAGCAGTGATGTTTTGTGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
940415304 2:153412723-153412745 CAGGCTGAATTGTAATTTCTTGG + Intergenic
941884992 2:170518840-170518862 CAGGTTGAATTAAAGTTCAGTGG + Intronic
942719460 2:178934374-178934396 AAGGTTGAATTCAAGCTTTGGGG + Intronic
943285323 2:185991311-185991333 CAGGCTGCTGTGAAGTTTTATGG - Intergenic
944606440 2:201355812-201355834 CAGGCTGAAATGCAGTGGTGTGG - Intronic
944654001 2:201859583-201859605 CTGGCTGAATTCAAAGTTTGGGG - Intronic
944877010 2:203972477-203972499 CACTGTGAAATGAAGTTTTGTGG + Intergenic
945146057 2:206739367-206739389 CAGGCTGAAGTGCAGTGGTGCGG - Intronic
945445153 2:209928289-209928311 CAGGCTGAAGTGCAGTGGTGCGG - Intronic
946114029 2:217446050-217446072 CAGGCTGAATTGATGTGGTCTGG + Intronic
946367446 2:219257699-219257721 CAGGCTGGATTGCAGTGCTGAGG + Intronic
946484378 2:220086857-220086879 CAGCCCGAAGTCAAGTTTTGGGG + Intergenic
946842991 2:223836682-223836704 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
947109604 2:226705048-226705070 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
947384976 2:229581901-229581923 CCAGCTGAATTTAAGATTTGTGG + Intronic
947855455 2:233320759-233320781 CAGGCTCTCTTGCAGTTTTGTGG - Exonic
947954875 2:234180078-234180100 CAGGCTGGAGTGAAGTAATGTGG - Intergenic
947963635 2:234260493-234260515 CAGGCTCAGTTCAAGTTTTAAGG - Intergenic
948897180 2:240932968-240932990 CAGGCTGAAGGGTAGTTATGGGG + Intronic
1169458909 20:5777483-5777505 CAGGCTGAAGTGCAGTATTGTGG + Intronic
1170473178 20:16688555-16688577 CAGCCTGGACTGAAGTTGTGTGG + Intergenic
1171183004 20:23104812-23104834 TAGGCTGAACTGAGGTTTTGTGG - Intergenic
1171422489 20:25026529-25026551 CAGGTTGACTTGAAGGGTTGGGG - Intronic
1172239497 20:33402983-33403005 CAGGCTGGAGTGCAGTGTTGAGG - Intergenic
1173155931 20:40608830-40608852 AATGCTGAATTGAAGTGTTAAGG - Intergenic
1174681637 20:52414444-52414466 TAGGCTGAGTTGAAGCTCTGTGG - Intergenic
1174780551 20:53385074-53385096 CAGGCTGGAATGCAGTGTTGTGG - Intronic
1176221832 20:63973272-63973294 CAGGCTGGAGTGCAGTTGTGTGG + Intronic
1177986576 21:27983047-27983069 CAGCCTGAATTCAAATTTTCAGG - Intergenic
1178575135 21:33780826-33780848 CAGGCTGTTTGGAATTTTTGTGG - Intronic
1178862284 21:36299458-36299480 CAGGCTGAGTTCTGGTTTTGAGG + Intergenic
1179004951 21:37505432-37505454 AAGGTTGAATTCGAGTTTTGGGG - Exonic
1179675876 21:42981801-42981823 CAGGCTGACTTCAAGTTGGGTGG + Intronic
1180874275 22:19167665-19167687 CAGGCTGAAGTGCAGTGATGTGG + Intergenic
1181402860 22:22661789-22661811 CAGGATGTATTGGGGTTTTGTGG + Intergenic
1181564945 22:23730404-23730426 CAGGCTGAAGTGCAGTATTGTGG - Intergenic
1182375370 22:29843378-29843400 CAGGCTGAAGTGCAGTGGTGTGG - Intergenic
1182454055 22:30438613-30438635 ATGGCTGAAATGAAGATTTGGGG - Intergenic
1184326476 22:43791326-43791348 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1184823895 22:46933902-46933924 CAGGCTGAGTTGAGGCTGTGTGG + Intronic
949194403 3:1288053-1288075 CAGGCTGAACCCCAGTTTTGGGG + Intronic
949484725 3:4527219-4527241 CAGGCTGGATTGCAATTGTGTGG + Intronic
951019878 3:17771086-17771108 TAGACTAAATGGAAGTTTTGTGG - Intronic
952077453 3:29714325-29714347 AAGGATGACTTCAAGTTTTGTGG + Intronic
952263997 3:31767846-31767868 CAGGCTGAACCCAAATTTTGAGG - Intronic
953556637 3:43951366-43951388 CAGGCACAACTGAAGTTTGGAGG + Intergenic
954738726 3:52729357-52729379 CAGGCTGGAGTGCAGTATTGGGG - Intronic
954973578 3:54672263-54672285 CTGGCTGCTTTGCAGTTTTGGGG + Intronic
955613390 3:60780778-60780800 CAGGCTGACTGGAGGTTTTTCGG - Intronic
955720898 3:61880166-61880188 CAGGCATAATTGATGTTCTGGGG + Intronic
956152624 3:66259421-66259443 AAGGCTGAGTTGAAGTCTGGGGG - Intronic
956198465 3:66678312-66678334 CAGGCTGGAGTGCAGTTGTGTGG + Intergenic
957563877 3:81860443-81860465 AAGGCTGAATCCAGGTTTTGGGG + Intergenic
958927130 3:100171137-100171159 CTGGCTGAATTAAAGCTATGAGG - Intronic
959286990 3:104427340-104427362 CAGGCTGGAGTGCAGTGTTGCGG - Intergenic
960710817 3:120526167-120526189 CAGGCTGAAATGCTGTGTTGTGG + Intergenic
961235315 3:125361379-125361401 CAAGCAGAATTGAAGTTATTGGG - Intronic
963623950 3:147647506-147647528 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
964793935 3:160477829-160477851 CAGACTGAAATGAAGCTTCGAGG - Intronic
965137938 3:164798400-164798422 CAGGTTGACTTCAAGATTTGTGG - Intergenic
965604649 3:170486016-170486038 AAGGCTGAAGTGAAGTCCTGGGG + Intronic
967414583 3:189202061-189202083 CAAGCTGATTAGAAGTTTTCAGG + Intronic
967863884 3:194174649-194174671 CAGGCTGAAGTGCAGTGATGTGG - Intergenic
969832040 4:9805649-9805671 CAGGCTGAAGTGCAGTGGTGCGG - Intronic
971204274 4:24548185-24548207 CAGGCTGGAGTGCAGTGTTGCGG + Intronic
971999983 4:34019291-34019313 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
972492585 4:39601900-39601922 CAGGCTGAAATGCAGTGGTGTGG - Intronic
974044138 4:56883471-56883493 CAGGCTGGAGTGCAGTGTTGTGG - Intergenic
974366892 4:60961812-60961834 AAGGCTGAAATGAAGTTGTCAGG - Intergenic
976906496 4:90243106-90243128 CAGGCTGAAGTGTAGTGGTGTGG + Intronic
977221087 4:94338378-94338400 CAGGCTGGAGTGAAGTGTCGCGG - Intronic
977745734 4:100544819-100544841 CAGGCAGCATTTAAGTTTGGAGG + Intronic
978158414 4:105516317-105516339 CAGGCTGGAATGAAGTGGTGTGG + Intergenic
978730239 4:112018073-112018095 AAGGATAAATTGAAGTTATGGGG - Intergenic
979190487 4:117850377-117850399 GAGGCTGTGGTGAAGTTTTGTGG - Intergenic
979485808 4:121269035-121269057 AGGGGTGAATTCAAGTTTTGTGG - Intergenic
979843969 4:125484828-125484850 AAGGCTGCATTGAAGATTTTTGG + Intronic
979933631 4:126664469-126664491 CTTTATGAATTGAAGTTTTGTGG + Intergenic
980078680 4:128321055-128321077 CAGGCTGAAGTGCAGTGGTGCGG + Intergenic
980094974 4:128480095-128480117 ATGGCTGAATTGAAGATATGTGG - Intergenic
980715197 4:136618274-136618296 TAGACTGAACTGAGGTTTTGGGG - Intergenic
982248466 4:153379803-153379825 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
982709248 4:158743725-158743747 CATGCTGAATTCCGGTTTTGGGG - Intergenic
986383848 5:7211665-7211687 CAGGCTGATATGAATTTTGGTGG + Intergenic
986666823 5:10111945-10111967 CAGGCTGCTTTGAATTTTAGAGG + Intergenic
987380957 5:17285589-17285611 CACGCTGATTTCAAATTTTGTGG - Intergenic
988733924 5:34002039-34002061 CAGGCTGAAGTGTAGTAGTGTGG + Intronic
989129071 5:38086535-38086557 GAGGCTGAATTGAAGTTTTAGGG + Intergenic
989743385 5:44798300-44798322 CAAGCTGAATTCCAATTTTGGGG + Intergenic
992271715 5:75071215-75071237 AAGACTAAAATGAAGTTTTGAGG + Intronic
992311500 5:75505240-75505262 CAGGCTGGAGTGCAGTTCTGTGG - Intronic
992475451 5:77097459-77097481 CAATATGGATTGAAGTTTTGTGG + Intergenic
992519406 5:77534733-77534755 TTGGTTAAATTGAAGTTTTGAGG - Intronic
993530795 5:89022764-89022786 CAGGCTGATATTAAGTTTTTGGG - Intergenic
995580920 5:113601251-113601273 CAGGATGACTTCAAGTTTTCTGG - Intergenic
996190427 5:120533958-120533980 CAAGGTGAATTTAAGTTTTGTGG + Intronic
996710215 5:126536075-126536097 CAGGCTGGAGTGCAGTGTTGTGG - Intergenic
998596609 5:143536791-143536813 CTGGCTGCCTTGAAGTTCTGAGG + Intergenic
998894325 5:146782491-146782513 CAGGCTGAAGTGAATTCATGTGG - Intronic
1000243798 5:159432415-159432437 CAGGCTGAAGTGCAGTTGTGTGG - Intergenic
1000371117 5:160537671-160537693 CATGCTGCATTGAAGTTTAATGG + Intergenic
1000524204 5:162335220-162335242 CAGCCTGGATTGAAGTGGTGGGG + Intergenic
1000770727 5:165350598-165350620 CAGGCTGAATTTCAGTTTGGGGG - Intergenic
1001047720 5:168387711-168387733 CAGGCTTAAATGAGGTCTTGAGG - Intronic
1001181286 5:169522946-169522968 CAGCCTCAATTGGAGTTCTGAGG - Intergenic
1002411230 5:179078392-179078414 CAGGCTGAGTAGAAGATATGAGG - Intronic
1003026694 6:2561255-2561277 CAGGTAGAGTTCAAGTTTTGGGG - Intergenic
1004217156 6:13713131-13713153 CAGGCTGGAGTGCAGTTGTGTGG + Intergenic
1004755476 6:18606031-18606053 TAGGCTGAATTGCAATTATGCGG - Intergenic
1006676148 6:35765061-35765083 CAGGCTGGAGTGCAGTGTTGCGG - Intergenic
1007672626 6:43568559-43568581 CAGGCTGGAGTGCAGTTGTGTGG - Intronic
1010159442 6:72834912-72834934 CTGGCTCAATTTCAGTTTTGTGG - Intronic
1011837275 6:91448669-91448691 CATGCTGAACTTAACTTTTGTGG - Intergenic
1012195806 6:96340604-96340626 TAGGCTGAATTTATGTGTTGTGG + Intergenic
1012622616 6:101364833-101364855 CTGGAAGAATTTAAGTTTTGTGG + Intergenic
1013429787 6:110045308-110045330 CATGCTGCATCCAAGTTTTGTGG - Intergenic
1014193727 6:118527390-118527412 CAGGCTGAACCCTAGTTTTGGGG + Intronic
1014498559 6:122157789-122157811 CAGGCTGGATTCAAGATATGAGG - Intergenic
1014538619 6:122647931-122647953 CTGTCTGAATTGAATTATTGTGG + Intronic
1019021036 6:168917944-168917966 CAGGCTGAAGTGCAGTGGTGTGG + Intergenic
1019806692 7:3131646-3131668 CAGGCTGAAGTGAATTTTGGGGG - Intergenic
1019815026 7:3193360-3193382 CAGGGTGAACCCAAGTTTTGGGG - Intergenic
1020402182 7:7791580-7791602 ACGGCTAAATTGATGTTTTGGGG + Intronic
1020839597 7:13199139-13199161 CAGGCTGAATTGAAATCTGAGGG + Intergenic
1021909061 7:25365988-25366010 CAGGCTGAATAGATATGTTGAGG - Intergenic
1022769292 7:33451876-33451898 CAGGCTGGAGTGCAGTTGTGTGG + Intronic
1023731041 7:43192803-43192825 CAGGCTGAATCCCAATTTTGGGG - Intronic
1024660020 7:51484771-51484793 CAGGCTGGAGTGCAGTTTCGTGG + Intergenic
1025095043 7:56090158-56090180 CAGGCTGAAGTGCAGTGGTGTGG + Intronic
1027436330 7:78168437-78168459 CAGACTGCCATGAAGTTTTGGGG + Intronic
1027812720 7:82925762-82925784 CAGGCTGAAGTGCAGTGGTGCGG + Intronic
1029369416 7:100138791-100138813 TAGGCTGAAGTGAAGTGTAGTGG - Intergenic
1031379183 7:121063790-121063812 TTGGTTGAAGTGAAGTTTTGTGG + Intronic
1034184747 7:149166727-149166749 AAGGCTGAGCTGAAGCTTTGTGG - Intronic
1034463181 7:151209789-151209811 CAGGGTGAACTGGAGTCTTGGGG - Intronic
1034603176 7:152282703-152282725 GAGGCTGAATGGAATTTCTGGGG + Intronic
1035891699 8:3351550-3351572 CAGGCTGAAATGTAGTTGGGTGG - Intronic
1036226588 8:6964035-6964057 CAAGATGAATTGCAGTCTTGCGG + Intergenic
1037000982 8:13718408-13718430 CAGGCTGAAGTGCAGTGTTAGGG - Intergenic
1037421157 8:18704380-18704402 CAGGCTGGAGTGCAGTTGTGTGG + Intronic
1037928252 8:22862102-22862124 CCGGCTGAACTGAAGGTATGGGG + Intronic
1038066813 8:23971923-23971945 GAGGGTGAATTGTGGTTTTGAGG + Intergenic
1038636263 8:29289850-29289872 CAGGCTGGAGTGCAGTTATGCGG + Intergenic
1039038069 8:33381090-33381112 CAGGCTGAAGTGCAGTGGTGTGG - Intronic
1039125362 8:34195461-34195483 CAAGCAGAATTAAAGTATTGAGG + Intergenic
1039421784 8:37449670-37449692 GAGGCTGAAGTTAAGTTTAGTGG + Intergenic
1040718434 8:50287571-50287593 TAGCCTGAATTGCAGTTCTGTGG + Intronic
1041584444 8:59499432-59499454 CAGGCTGGATTCCAGTTTTCTGG - Intergenic
1044113736 8:88308151-88308173 CAGGGTGAAGTGAAGAATTGTGG - Intronic
1044182849 8:89217412-89217434 CAGGCTGAATAGAGGAATTGAGG + Intergenic
1045649405 8:104328357-104328379 CAGGCTGAATACAGGTTCTGAGG + Intergenic
1046940200 8:119923451-119923473 CAGGCTGATTTGAACTCCTGAGG + Intronic
1047071365 8:121347559-121347581 CAGACTGAGTTAAAGGTTTGGGG - Intergenic
1047103435 8:121706750-121706772 CAGGCTGGACTGCAGTGTTGCGG + Intergenic
1047702604 8:127464644-127464666 CAAGCTGAACTGAAATTTTCTGG - Intergenic
1048635871 8:136294696-136294718 CAGGGTCAATTTGAGTTTTGAGG - Intergenic
1048841467 8:138570276-138570298 CAGGCTGAAGTGAAGTAGCGTGG - Intergenic
1049853405 8:144846741-144846763 CAGGCTGAAGTGCAGTGGTGCGG + Intronic
1050180901 9:2921709-2921731 AAGTCTGCAATGAAGTTTTGTGG + Intergenic
1050346626 9:4695227-4695249 CAGGCTGAAGTGCAGTGGTGAGG + Intronic
1052100071 9:24435444-24435466 CAGGCTGGAGTGAAGTGGTGTGG + Intergenic
1052686494 9:31764321-31764343 CAGGCTGCATTCAGGTTCTGAGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054764480 9:69032080-69032102 CAGGCTGAAATGCAGTGGTGTGG - Intergenic
1054774856 9:69116659-69116681 CAGGCTGAAGTGGAGTTCAGTGG + Intergenic
1054821006 9:69520615-69520637 CTGGCTGAGTTGAAGTGTTATGG - Intronic
1055498581 9:76881003-76881025 CAGGCTGGAGTGCAGTTGTGTGG + Intronic
1055713796 9:79094967-79094989 CAGGAAGTATTGTAGTTTTGAGG + Intergenic
1055962367 9:81832803-81832825 ACAGCTGACTTGAAGTTTTGTGG - Intergenic
1056043697 9:82695039-82695061 GAGGCTGTGGTGAAGTTTTGTGG + Intergenic
1056271184 9:84949510-84949532 CAGGCTGGAGTGCAGTTATGTGG + Intronic
1056580534 9:87885994-87886016 CAGGCTGGAGTGAAATGTTGGGG - Exonic
1057203432 9:93156211-93156233 GAGGCTGAAGTGACGTTCTGCGG - Intergenic
1058875355 9:109239307-109239329 CAGGCAGAAGAAAAGTTTTGTGG + Intronic
1060407646 9:123380823-123380845 CAGAATCAACTGAAGTTTTGGGG + Exonic
1061260558 9:129478608-129478630 CAGGCTGGAGTGCAGTTGTGTGG - Intergenic
1061614442 9:131770702-131770724 CTTGCTGGCTTGAAGTTTTGGGG - Intergenic
1185717257 X:2352869-2352891 TAAGGAGAATTGAAGTTTTGTGG - Intronic
1187114539 X:16335810-16335832 CATGGTGACTTGAAATTTTGGGG - Intergenic
1187319044 X:18223948-18223970 CAGGCTGGAGTGCAGTTTCGTGG - Intergenic
1187717975 X:22122707-22122729 CAGGCTGGCTTGAATTTCTGGGG + Intronic
1188127333 X:26385157-26385179 CAGGCCAAAGTGAAGTTTTGTGG + Intergenic
1188191157 X:27173159-27173181 CAGGATGAATTGGAGATTTCAGG - Intergenic
1188967604 X:36574291-36574313 CAGGTAGAATTGAACTTTTCTGG - Intergenic
1191905021 X:66078271-66078293 CATCCTGAATTGATATTTTGGGG + Intergenic
1192890600 X:75386518-75386540 CAGGCTGGAGTGCAGTTGTGTGG + Intronic
1197236651 X:124073460-124073482 CAGGCTGGAGTGAAGTGGTGTGG + Intronic
1198413489 X:136395207-136395229 CAGACTAAATTGACTTTTTGGGG - Intronic
1199327987 X:146523871-146523893 CAAGCAGAATAGAAGTTTGGAGG - Intergenic
1201777939 Y:17686919-17686941 CAGACTTAATTCAAGTTGTGAGG - Intergenic
1201823619 Y:18219073-18219095 CAGACTTAATTCAAGTTGTGAGG + Intergenic