ID: 903708346

View in Genome Browser
Species Human (GRCh38)
Location 1:25303399-25303421
Sequence TGCCATGGTGCTGGGTCTTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 2, 1: 0, 2: 1, 3: 37, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903708337_903708346 8 Left 903708337 1:25303368-25303390 CCTCGTGTCACCTGATCCCTTCT 0: 2
1: 0
2: 0
3: 7
4: 246
Right 903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG 0: 2
1: 0
2: 1
3: 37
4: 308
903708339_903708346 -2 Left 903708339 1:25303378-25303400 CCTGATCCCTTCTCCGTGGCTTG 0: 2
1: 0
2: 1
3: 11
4: 143
Right 903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG 0: 2
1: 0
2: 1
3: 37
4: 308
903708340_903708346 -8 Left 903708340 1:25303384-25303406 CCCTTCTCCGTGGCTTGCCATGG 0: 2
1: 0
2: 2
3: 12
4: 196
Right 903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG 0: 2
1: 0
2: 1
3: 37
4: 308
903708342_903708346 -9 Left 903708342 1:25303385-25303407 CCTTCTCCGTGGCTTGCCATGGT 0: 2
1: 0
2: 1
3: 20
4: 250
Right 903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG 0: 2
1: 0
2: 1
3: 37
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903708346 Original CRISPR TGCCATGGTGCTGGGTCTTG TGG Exonic
900129686 1:1082087-1082109 TGCCCTGGCGCTGAGTCCTGGGG - Exonic
901607265 1:10469013-10469035 AGACATGGTGCTGAGTCCTGGGG - Intronic
902188208 1:14741266-14741288 AGGCATGGTGCTGGGTGCTGGGG - Intronic
902528369 1:17074520-17074542 TGACATGCAGCTGGGTCTGGTGG - Intronic
902684951 1:18070331-18070353 GGCCAGGGTGGAGGGTCTTGAGG + Intergenic
902983076 1:20139411-20139433 TGCCATGTTGCGGGTTCTGGGGG - Exonic
903002665 1:20277387-20277409 TGCCAAGGTCCTGGTTCTTTTGG + Intergenic
903380717 1:22895378-22895400 TGCCATGCTGCTGGGTCTCCTGG - Intronic
903442973 1:23402080-23402102 TGCCAAAGTGCTGGGACTTTAGG - Intronic
903708346 1:25303399-25303421 TGCCATGGTGCTGGGTCTTGTGG + Exonic
903718768 1:25389014-25389036 TGCCATGGTGCTGGGTCTTGTGG - Exonic
905618389 1:39417939-39417961 TGACATGGTCCTTGGCCTTGTGG + Intronic
906520497 1:46464299-46464321 TGACAAGGAGCTGGGTTTTGGGG + Intergenic
907025492 1:51113890-51113912 TGCCATTGTTCTAGGTATTGAGG + Intronic
911480856 1:98438369-98438391 TGGCAGGGTGCTGGGGATTGTGG - Intergenic
912515102 1:110212088-110212110 GGCCATGGCGCCGGGTCTGGGGG + Exonic
913390326 1:118303612-118303634 TGCCATTGAGCTGGCCCTTGAGG - Intergenic
916189912 1:162168610-162168632 TGTCATTGTGCTGAGGCTTGTGG + Intronic
916196289 1:162226316-162226338 TGCTATGGTGCTAGGCCCTGGGG + Intronic
916715124 1:167441441-167441463 GGCCATGGAGCTGGGACTAGGGG - Intronic
917781437 1:178401485-178401507 TTCCATGGGGCTGGGCCTGGTGG + Intronic
918250925 1:182702463-182702485 TTGCATGATGCTGGGTTTTGGGG - Intergenic
921344478 1:214168203-214168225 TGCCCTGGTTCTTGTTCTTGGGG + Intergenic
922573713 1:226648237-226648259 TGCCATGGTCCTGGGGGTTGCGG - Intronic
923542677 1:234899842-234899864 TGCCATGGCGCAGAGTCGTGGGG + Intergenic
923641887 1:235771695-235771717 TGCCATGTTTCTGGATTTTGTGG - Intronic
924495680 1:244586270-244586292 AGCCATGGTGCTTGATCCTGAGG + Intronic
1063371558 10:5525805-5525827 TGCCCTGGTGCTCGGTCCTAAGG - Exonic
1063949265 10:11207369-11207391 TGCCAGGGGCCTGGATCTTGTGG + Intronic
1063987885 10:11526391-11526413 AGGCATCGTGCTGGGCCTTGGGG - Intronic
1064989795 10:21246182-21246204 TGGCATGGTGCAAGGTGTTGAGG - Intergenic
1065674313 10:28157742-28157764 TGCAATGTTCCTGAGTCTTGGGG + Intronic
1065851885 10:29797148-29797170 TGCCCTTATGCTGGGGCTTGAGG + Intergenic
1066554001 10:36591125-36591147 GGAGAAGGTGCTGGGTCTTGTGG + Intergenic
1067053948 10:43040650-43040672 TGCCATGCTGTGGGGTATTGTGG + Intergenic
1067428444 10:46226571-46226593 TGCCTTTTTGCTGGGGCTTGTGG + Intergenic
1068299657 10:55121799-55121821 TGCCTTGTTGCTGGGTCCTCTGG - Intronic
1068583938 10:58775248-58775270 TCCCATGTTGCTGGGTCTACAGG - Intronic
1069766611 10:70866126-70866148 TCCCATGGTGCTGGGACTACAGG - Intronic
1069822136 10:71234765-71234787 TTCCAGGCTGCTGGGTCTGGGGG + Intronic
1069885836 10:71623041-71623063 TGCCACTGTGCTAGGTCCTGGGG + Intronic
1069959967 10:72073789-72073811 TGCCAGGGAGCTGGGTCAGGTGG - Intronic
1070499914 10:77062982-77063004 AGCTATGGTGATGGGTCCTGTGG + Intronic
1070794214 10:79207553-79207575 TGCCAGGGTGCTGGGCCTCCTGG - Intronic
1071503290 10:86218481-86218503 GGCCTTGGAGCTGGGGCTTGGGG - Intronic
1072176150 10:92923880-92923902 TACCATGGTGCATTGTCTTGAGG + Intronic
1072486214 10:95858329-95858351 AGCCAGGGTGCTGGGTATGGTGG + Intronic
1075689913 10:124387761-124387783 TGCCAAGGTGCTGTATTTTGGGG - Intergenic
1076787320 10:132757781-132757803 CGCCATGGTGCTGGGCTGTGGGG - Intronic
1076787363 10:132757933-132757955 CGCCATGGTGCTGGGCTGTGGGG - Intronic
1076787525 10:132758477-132758499 CGCCATGGTGCTGGGCTGTGGGG - Intronic
1077365870 11:2161351-2161373 TTCCCTGGTGCTGGGTCTGTGGG + Intergenic
1077582776 11:3427612-3427634 AGCCACCGTGCTCGGTCTTGTGG + Intergenic
1077601468 11:3577790-3577812 TGCCGAGGTGCCTGGTCTTGGGG + Intergenic
1077889643 11:6409937-6409959 TGCAATGGTGCTGGAGCATGTGG + Intronic
1078384843 11:10880500-10880522 AGCAATGGGGATGGGTCTTGAGG - Intergenic
1080026862 11:27624378-27624400 TGCCATGGATCTTGGTTTTGGGG - Intergenic
1081631374 11:44692333-44692355 TGACATGGGGCTGTGTCTTTAGG - Intergenic
1082188024 11:49208224-49208246 TGCCGCGGTGCTGGGACTCGCGG - Intronic
1083796792 11:65021601-65021623 TGACATGGAGCAGGGCCTTGAGG + Intronic
1084815399 11:71642902-71642924 TGCCGAGGTGCCTGGTCTTGAGG - Intergenic
1084897307 11:72282746-72282768 TGCCATGGGGCTGGGAGGTGGGG + Intergenic
1086043783 11:82509397-82509419 TGTCAGGGAGCTGGCTCTTGAGG - Intergenic
1089443329 11:118533290-118533312 TGCCCTGTGGTTGGGTCTTGTGG + Intronic
1089502230 11:118939557-118939579 TGCCATGGTGATGGGTCCAGAGG + Intronic
1090751266 11:129748366-129748388 TGTCATGGTGCTGGGTACAGGGG + Intergenic
1091693140 12:2610591-2610613 TGTACTGGTGCTGGTTCTTGGGG - Exonic
1091812186 12:3409020-3409042 TGCAGTGGTGCTGGGTTCTGGGG + Intronic
1092427616 12:8387148-8387170 TGCCAAGATGCCTGGTCTTGGGG + Intergenic
1093543568 12:20317875-20317897 TGCCTTGATGCTGTGTCTTTAGG - Intergenic
1093771554 12:23023549-23023571 TGCCAAGGAGCTGGGTCCTTAGG + Intergenic
1095386394 12:41655524-41655546 TTGCATGATGCTGGGTTTTGGGG + Intergenic
1095546685 12:43379569-43379591 TGCCAAGGTACTGTGTGTTGGGG - Intronic
1095961778 12:47839428-47839450 TGCTGTGCTTCTGGGTCTTGAGG + Intergenic
1096654145 12:53078199-53078221 TGCCATGATCCTGGGCCTGGTGG + Intronic
1098117638 12:67197084-67197106 TCCCAAAGTGCTGGGTCTAGGGG + Intergenic
1099510401 12:83528977-83528999 TGCCATGGTCCTGGGGCATGAGG + Intergenic
1099776525 12:87138556-87138578 TGCCATGATGCTGGATCATACGG + Intergenic
1100632603 12:96403184-96403206 GGCCATGGGGCTGGGTGCTGTGG - Intergenic
1101142785 12:101813118-101813140 TTCCATGGGGCTGGGTGTGGTGG - Intronic
1101527499 12:105544836-105544858 TCCCAAGGAGCTGGATCTTGAGG + Intergenic
1101746227 12:107543972-107543994 TGCCGTGGTGCTTGGCATTGAGG - Exonic
1102514174 12:113435386-113435408 TGCCCTGGTGCTGGCAGTTGGGG + Exonic
1102696069 12:114800403-114800425 TGGCATGATGCTGAGGCTTGAGG + Intergenic
1103221880 12:119253084-119253106 GTCCAGGGTGCTGGGTCCTGTGG - Intergenic
1104504805 12:129321524-129321546 TGCCATGGTCCTGAGGCGTGAGG - Intronic
1106613845 13:31308846-31308868 TGCCATGGTTCTGAGGCTAGTGG + Intronic
1106887676 13:34207250-34207272 TGCCATGCTGCTGGCTTTTAAGG - Intergenic
1107394580 13:40002335-40002357 TGCTTTGGTACTAGGTCTTGCGG + Intergenic
1107402601 13:40084063-40084085 TTCCATGGTTCTGGGTTTTATGG + Intergenic
1108502889 13:51084430-51084452 TGCCCTAGTCCTGGGTCTTGGGG + Intergenic
1110493277 13:76134922-76134944 TGACATGTTGCTGGGACTGGTGG + Intergenic
1110660374 13:78053683-78053705 AGAGATGGTGCTAGGTCTTGAGG - Intergenic
1111843149 13:93474011-93474033 TGCCATGGTGCTGGCTGCAGTGG - Intronic
1112051032 13:95644121-95644143 TGCCATGCGCCTGGGACTTGAGG - Intronic
1112793238 13:103027530-103027552 CGCCTTGGTGCTGGGCCATGAGG + Intergenic
1112810209 13:103209525-103209547 TGCCAAAGTGCTGGGACTTCAGG + Intergenic
1113114481 13:106860792-106860814 TGCCAAGGTGCTATGTTTTGAGG - Intergenic
1113854452 13:113436012-113436034 TGCCTGGGTGCTGGGTCCCGGGG - Intronic
1113854815 13:113437356-113437378 CGCCTGGGTGCTGGGTCCTGGGG - Intronic
1115165081 14:30439257-30439279 TGCCAAGGTGCTAGATTTTGGGG - Intergenic
1115953024 14:38743132-38743154 TGCCAGGGTGCTGGGATGTGGGG - Intergenic
1118975834 14:70675902-70675924 AGCCATTGTGCTGGGTCTCTGGG + Intergenic
1120261251 14:82188927-82188949 TGCGCTGGAGCTGGGTCATGGGG + Intergenic
1121520723 14:94584547-94584569 TGGCAGGGGGCGGGGTCTTGAGG + Intronic
1122433919 14:101679298-101679320 TGCAATAGTTCTGGGCCTTGAGG + Intergenic
1122593308 14:102871058-102871080 TGGCATTGTGCTGGGTGCTGGGG + Intronic
1123818628 15:24004024-24004046 TGCCATGGAGATGGGTGTAGGGG + Intergenic
1125505056 15:40263011-40263033 AGCCATGCTTCTGGGTCTTGAGG - Intronic
1125795875 15:42403582-42403604 TGACATGGGGCTGGTTCCTGGGG + Intronic
1126331634 15:47538394-47538416 TGACATGCTGCTGGGTCCTGTGG - Intronic
1126786304 15:52180039-52180061 CGCCCAGGTGCGGGGTCTTGGGG - Intronic
1127842398 15:62842608-62842630 TGCCTTGGTCCTGGGTTTTCAGG - Exonic
1128051336 15:64667419-64667441 TGCCTTGGAGCTGGGTGTGGTGG + Intronic
1130620225 15:85454102-85454124 TGCCATGGAAGTGGGTCCTGTGG + Intronic
1131191505 15:90320372-90320394 TGACATAGTGCTGGGGCTGGCGG - Intergenic
1131464715 15:92645912-92645934 AGCCATGCAGCTGGGCCTTGGGG - Intronic
1131847540 15:96503685-96503707 AGGCATGGTACTAGGTCTTGAGG + Intergenic
1131874757 15:96792972-96792994 AGCCATGGATCTGGGGCTTGTGG - Intergenic
1132481527 16:168675-168697 TGCCGTGGTGCTGTCTCCTGAGG + Intergenic
1132509845 16:334026-334048 TGCTATGGTACTGGGTGCTGTGG - Intronic
1132525310 16:411305-411327 GGGGAGGGTGCTGGGTCTTGGGG + Intronic
1132574369 16:657786-657808 TGCCAGGGCGCTGGGGCTCGCGG - Exonic
1133370631 16:5243230-5243252 TGCCGAGGTGCCTGGTCTTGGGG - Intergenic
1133881450 16:9786385-9786407 TCCCACGGTGCTGGGGCCTGAGG + Intronic
1134330662 16:13248306-13248328 AGCCATGGTGCCGGGCCTTGAGG + Intergenic
1136267204 16:29128775-29128797 TGCCACGAGGCTGGTTCTTGTGG + Intergenic
1137701642 16:50502068-50502090 TGGCATGGAGCAGGGTCTGGAGG - Intergenic
1138474943 16:57265074-57265096 TGGCAGGGTGCTGTGTGTTGGGG - Intronic
1139738836 16:69017307-69017329 TGCCACTGTGCTGGGCCCTGGGG - Intronic
1140831501 16:78755668-78755690 GGCCCTGGTGCAGGGTCCTGAGG - Intronic
1140931615 16:79633293-79633315 TTGCATGGTGCTGGGTCTTGGGG + Intergenic
1141629492 16:85279318-85279340 TGCCATGGGGCTGTGTGTGGTGG + Intergenic
1141712395 16:85707723-85707745 CGCCATGGTCCTGGCTGTTGGGG - Exonic
1142001191 16:87665322-87665344 CCCCATTGTGCAGGGTCTTGGGG + Intronic
1142070496 16:88089098-88089120 TGCCACGAGGCTGGTTCTTGTGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1143146633 17:4780834-4780856 TGCTGTGGTGCTGGGTGCTGTGG + Exonic
1143295727 17:5870460-5870482 AGCCATGGTGCTGGATGGTGTGG - Intronic
1144204875 17:12973191-12973213 CTCCATGGTCCAGGGTCTTGGGG - Intronic
1144734140 17:17545469-17545491 GGCCCTGGGGCTGGGACTTGTGG - Intronic
1145001584 17:19308846-19308868 AACCATGGTGCTGGGTGCTGGGG - Intronic
1145396161 17:22496659-22496681 TGCCATGGGGCAGGGGGTTGGGG + Intergenic
1146675073 17:34767789-34767811 TACGATGGTGCTGGGGGTTGGGG - Intergenic
1147760143 17:42792713-42792735 TGGCATTGTGCTGGGTACTGTGG - Intronic
1148209455 17:45799575-45799597 GGCCAAGGTCCTGGGTCCTGGGG - Intronic
1150281049 17:63929872-63929894 TGCCAAGGTGCTGAATCCTGCGG + Exonic
1157330243 18:46698773-46698795 TGCCCTCTTGCTGGGTCATGTGG - Intronic
1159557681 18:69962445-69962467 TGCTAAGGTGGTGGGTTTTGGGG - Intergenic
1161877347 19:6921970-6921992 TCCCATGGGGTTGGGTGTTGTGG + Intronic
1161939909 19:7395621-7395643 TACGACGGTGCTGGGTATTGTGG - Intronic
1164703400 19:30302370-30302392 AGCCATGGTTCTGCGTCTTTGGG + Intronic
1164708227 19:30335978-30336000 TGCCAAGATGCTGCTTCTTGGGG - Intronic
1164964196 19:32466574-32466596 TGCCCTGGGGCTGGGGCTAGGGG + Intronic
1165235904 19:34421386-34421408 AGCCATGGTGCTAGGTTTTTGGG + Intronic
1166528954 19:43531018-43531040 TCCCATGGTGCTGGGATTTCAGG - Intronic
1167713420 19:51125778-51125800 TGCCATGGTCCTGGGGCTGTGGG - Exonic
1167716292 19:51144587-51144609 TGCCGTGGTGCTGGGGCTGTGGG - Exonic
1167722003 19:51185620-51185642 TGCCATGGTCCTGGGGCTTTGGG - Intergenic
1167762323 19:51457536-51457558 TGCCGTGGTCCTGGGGCTTTGGG + Exonic
1167768438 19:51499513-51499535 TGCCATGGTCCTGGGGCTGTGGG + Exonic
1167785005 19:51629433-51629455 TGCCATGGTCCTCGGGCCTGGGG + Exonic
1167787106 19:51645857-51645879 TGCCATGGTCCTCGGGCCTGGGG + Exonic
925185123 2:1842063-1842085 TGCCATGCTATTGGGTCTTGTGG + Intronic
925300565 2:2808730-2808752 TGGCATGGAGCAGGGGCTTGGGG + Intergenic
926687057 2:15706099-15706121 TGGCATTGTTCTGGGTCCTGGGG - Intronic
928179959 2:29062120-29062142 TGCCAAGGTGCTGGGGGCTGGGG - Exonic
929498002 2:42463565-42463587 TGCCCTGGTGCTGGGTTATGAGG - Intronic
929650388 2:43674695-43674717 TGCCATGGGGCTGCGTGTGGTGG + Intronic
929820692 2:45271260-45271282 TCCCAGAGGGCTGGGTCTTGGGG - Intergenic
930094781 2:47558808-47558830 TGTGATGGTGCTGGGCCGTGTGG + Intronic
931286675 2:60837968-60837990 TGCCAAGGTGCTGTATTTTGGGG - Intergenic
931339068 2:61380904-61380926 TGCCATGCCGATTGGTCTTGTGG - Intronic
934613063 2:95754986-95755008 TGCCATGGCGTGGGGACTTGTGG + Intergenic
934647841 2:96069436-96069458 TGCCATGGTGTGGGGACTTGTGG - Intergenic
934841213 2:97625257-97625279 TGCCATGGTGTGGGGACTTGTGG - Intergenic
938119524 2:128623823-128623845 GGCCATGGTGATGGGTCTGAGGG + Intergenic
940019379 2:149140748-149140770 TGCCACGATGCTGGATTTTGTGG - Intronic
941594700 2:167461239-167461261 TGCCATAGGGCTAGGTCTAGGGG + Intergenic
942004709 2:171686423-171686445 AGCAATGGTGATGGGTGTTGTGG - Intergenic
945023404 2:205596662-205596684 TGCTTTGGTGCTGGGTATGGGGG + Intronic
945297343 2:208183646-208183668 TGCATTGGAGCTGGGGCTTGTGG + Intronic
946155528 2:217804412-217804434 TGCCATGGGGAAGGGGCTTGTGG - Exonic
946410121 2:219511574-219511596 TGCCGGGGAGCTGGGTGTTGCGG - Intergenic
946517743 2:220431506-220431528 TGCCATTGAGCTGGGGCTGGAGG + Intergenic
946767241 2:223051985-223052007 TGGCCGGGTGCTGGGGCTTGAGG + Exonic
947117828 2:226791173-226791195 TGCCATCGTTTTGGGTCATGGGG - Intronic
948142349 2:235682945-235682967 TGCCATGGTTCTGTGTCTATGGG + Intronic
1169930941 20:10832420-10832442 TGCCAGGGAGCTGGGTGTTGAGG - Intergenic
1170347559 20:15403624-15403646 TGTCATGGTTCTGGGCCATGCGG + Intronic
1171277198 20:23867468-23867490 TCACATGGTGCTGGGTGCTGGGG - Intergenic
1172119665 20:32590606-32590628 TGCCATGAGGCTGGGTGTGGTGG + Intronic
1173206907 20:41002392-41002414 TGCCATGGTCCTGAGGCTGGAGG - Intergenic
1176063262 20:63181450-63181472 TGCCAGGGGGCTTGGACTTGAGG - Intergenic
1176127684 20:63483267-63483289 TGCCAAGGGGCTGGGCTTTGCGG - Intergenic
1176340692 21:5692615-5692637 TGCCAAGGTCCTGAGACTTGGGG - Intergenic
1176472946 21:7124768-7124790 TGCCAAGGTCCTGAGACTTGGGG - Intergenic
1176504135 21:7631841-7631863 TGCCAAGGTCCTGAGACTTGGGG + Intergenic
1179309680 21:40184725-40184747 TGACATTGTGCTGGGTGCTGGGG + Intronic
1179548490 21:42127504-42127526 TGTCATGGACCTGGGTTTTGGGG + Intronic
1179881508 21:44295046-44295068 TGCCCTGGAGCTGGGTGTGGGGG + Intronic
1180870012 22:19140650-19140672 TGCCCTGGTGCTGCGTGTGGTGG + Intronic
1181392756 22:22595475-22595497 TGTCATGGAGCTGGGGCTTGAGG - Intergenic
1184278438 22:43423962-43423984 GGCCATTGTGCTGTGTGTTGGGG + Intronic
1185341928 22:50294846-50294868 TCCCATGCTGGTGGGGCTTGGGG + Intronic
1203239955 22_KI270733v1_random:7073-7095 TGCCAAGGTCCTGAGACTTGGGG - Intergenic
950041087 3:9919932-9919954 TACCATGGTGCAGGGTGTTGGGG + Intronic
950102061 3:10363496-10363518 TGGCATGGTGTTGGGCCTTTAGG + Intronic
950509284 3:13416045-13416067 TGCCGTGGAGCTTGGCCTTGGGG - Intronic
953920773 3:46949713-46949735 TTTCATGGTGCAGGGTCATGCGG - Intronic
954131637 3:48564099-48564121 TGACATGGTGCTGATTCTGGGGG - Exonic
957072313 3:75576843-75576865 TGCCGAGGTGCCTGGTCTTGAGG + Intergenic
958880666 3:99665404-99665426 TGCCATAGGGCTGGTTCTTCTGG + Intronic
959952670 3:112197505-112197527 TGCCATGGTGCTGAGGGGTGAGG + Intronic
960142942 3:114168617-114168639 TGCCATGGTGCTGGGGGCTATGG + Intronic
960584657 3:119309778-119309800 TTCCATGGTGCTGGTGGTTGTGG - Intronic
960604619 3:119492135-119492157 TGCCATAGGGTTGGTTCTTGAGG + Intronic
961281756 3:125769929-125769951 TGCCAAGATGCCTGGTCTTGGGG - Intergenic
961455034 3:127019799-127019821 TGCAATGGTGTGGGGGCTTGGGG + Intronic
961872589 3:129999655-129999677 TGCCAAGGTGCCTGGTCTTGAGG + Intergenic
963422991 3:145086338-145086360 TGCTATGCTGCTGGGTCTCAAGG + Intergenic
964507700 3:157417617-157417639 TGCCATGTAGCTGGGTCATGGGG - Intronic
967010728 3:185430965-185430987 TGCCATGATCCTGTTTCTTGAGG - Intronic
969015905 4:4104157-4104179 TGCCTAGGTGCCTGGTCTTGAGG + Intergenic
969045588 4:4334253-4334275 TGCCTCTGTGCTGGGTCTTTGGG + Intergenic
969797236 4:9535742-9535764 TGCCAAGGTGCCTGGTCTTGAGG - Intergenic
971019287 4:22517315-22517337 TTCCAGGGTCCTGGGTCTTGGGG + Intergenic
971182582 4:24343449-24343471 TGCCTTGTTGCTGCGTCCTGTGG - Intergenic
975544293 4:75545809-75545831 TGTCCTGCTGCTGGGCCTTGAGG - Intronic
975646996 4:76555403-76555425 AGGCAGGGTGCTGGTTCTTGAGG + Intronic
976529271 4:86132982-86133004 TTCCATGGGCCTGGGGCTTGAGG - Intronic
976774062 4:88687989-88688011 AGCCATAGTGCTGGGTATAGAGG + Intronic
977427266 4:96883128-96883150 TGCCTTGTTGCTGTGTCTTGTGG - Intergenic
978317056 4:107450045-107450067 TGCCAAGGTGGTGGATTTTGAGG - Intergenic
984067037 4:175061922-175061944 TCCCAAGGTGCTGGGACTAGAGG - Intergenic
985797225 5:1972223-1972245 TGCGATGGAGCTGGAGCTTGCGG + Intergenic
988496089 5:31747489-31747511 TGACAAGGTGCTGTGTTTTGGGG + Intronic
988523102 5:31963844-31963866 TGCCTGGGTGCTGGGCATTGGGG - Intronic
992179677 5:74183963-74183985 TGCTGTGGAGCTGGGGCTTGAGG - Intergenic
993221092 5:85098093-85098115 TGCAATGGTGTTGGGACTGGGGG + Intergenic
994015969 5:94965888-94965910 TGCCTTGTTGCTGGGTCCTCTGG - Intronic
994578948 5:101614301-101614323 TCCCATGGTTCAAGGTCTTGGGG - Intergenic
997225566 5:132207357-132207379 TGCTATGAAGCTGGGTCCTGTGG - Intronic
997361572 5:133298688-133298710 AGCCATGGTGCTGATTCATGTGG + Intronic
997889566 5:137663342-137663364 TGCCCTGGGGCTGGGGCTGGTGG - Intronic
997998461 5:138605321-138605343 TGCCCTGGTGCTGAGTGGTGTGG - Intergenic
998661609 5:144245139-144245161 TGCTATTGTGCTGGGTGATGAGG + Intronic
998668885 5:144331304-144331326 TGTAATGGTGCTGTGCCTTGAGG - Intronic
999245929 5:150154773-150154795 GGTCATGCTGCTGGGTCTGGGGG - Intronic
999456750 5:151723267-151723289 TGCCCTGGTGCAGGGTTCTGAGG - Intergenic
1000888937 5:166781520-166781542 TGCCATGGAGCTTGTTTTTGAGG - Intergenic
1001567015 5:172706453-172706475 TGTGATGGTACTGGGACTTGGGG + Intergenic
1001746718 5:174098215-174098237 TGTCAGGGTGCTGGGGCTGGAGG + Intronic
1002402490 5:178998928-178998950 TGCCATCGTGGTGGGTTCTGGGG + Intergenic
1002578059 5:180188737-180188759 TGGCATGATGCTGAGGCTTGGGG + Intronic
1003124970 6:3348845-3348867 TGCCCTGGCTCTGGGTCATGGGG - Intronic
1003250755 6:4427696-4427718 TACCACGGTGCTGGGCATTGGGG + Intergenic
1003478854 6:6512605-6512627 TGCCATGATCCTGGATCATGAGG - Intergenic
1003563302 6:7201839-7201861 TGCCATGCTGCAGGTTCTTCTGG + Intronic
1007104404 6:39273571-39273593 AGCCCTGGTTCTTGGTCTTGGGG + Intergenic
1007881726 6:45175673-45175695 TACCATGGTGCTAGGCCCTGAGG + Intronic
1008141096 6:47833290-47833312 TGCTATGGTGCTGGGTTTATAGG - Intergenic
1010516872 6:76784177-76784199 TGTGATGGTGCTGGGTGTTGGGG + Intergenic
1013113668 6:107084198-107084220 TGCCCTAGTGCTGGTTCCTGTGG - Intronic
1014206992 6:118666688-118666710 TGTCAGGGAGCTGGATCTTGAGG - Intronic
1014860921 6:126467472-126467494 TCCCATGTTTCTGGGTTTTGTGG - Intergenic
1015081458 6:129230479-129230501 TGGAATGGTGCTGGGACATGTGG + Intronic
1019757443 7:2783322-2783344 TGCCATGGTGCTAGGTATGTGGG + Intronic
1021353653 7:19627751-19627773 ACCCATGGTGCTGAGGCTTGGGG - Intergenic
1024959568 7:54960125-54960147 TGCCAGGATGCTGGGTACTGTGG - Intergenic
1025156553 7:56612274-56612296 CACCTGGGTGCTGGGTCTTGAGG + Intergenic
1026081288 7:67223760-67223782 TGCCATGGGGCTGAGTCATCGGG + Intronic
1026432420 7:70360396-70360418 TCCCAAAGTGCTGGGACTTGAGG + Intronic
1026632265 7:72047753-72047775 AGCCATCGTGCTCGGCCTTGGGG + Intronic
1026695792 7:72590243-72590265 TGCCATGGGGCTGAGTCGTCAGG - Intronic
1027815244 7:82959956-82959978 TCCCATGGTGGTGTATCTTGAGG + Intronic
1029002170 7:97165900-97165922 TGGCATGATCCTGTGTCTTGAGG + Intronic
1029074581 7:97925802-97925824 TGCCGAGGTGCCTGGTCTTGGGG + Intergenic
1029259836 7:99294379-99294401 GGCCATTGTGCTTGGTTTTGTGG - Intergenic
1029307856 7:99634112-99634134 TGCCGTGCTGCTGGGTAATGAGG + Intergenic
1031300452 7:120056967-120056989 TGCCATGTTGCATGTTCTTGGGG - Intergenic
1032338291 7:131046485-131046507 TACCATGGCGCTGGCTTTTGAGG - Intergenic
1032453820 7:132056800-132056822 TGCCATGCTGCTGGGTCTAATGG - Intergenic
1033540589 7:142352498-142352520 TCCCATGGTGCCTGGTGTTGGGG + Intergenic
1033591959 7:142816399-142816421 TGCCATGCTGCTGGCCCTGGAGG + Intergenic
1034029434 7:147743853-147743875 TGCCATGGTGATGGCTACTGTGG + Intronic
1034349531 7:150407179-150407201 TGGCATGGTGCTAGGTGCTGGGG + Intronic
1034475957 7:151282143-151282165 AGCCTTGGTGCTGAGTGTTGAGG + Intergenic
1034704864 7:153132145-153132167 TGCCATGGTGCTGGGATTACAGG + Intergenic
1035590109 8:806275-806297 TGTCATGGCGCTGGGTCTCAAGG + Intergenic
1036053814 8:5228491-5228513 TGACATGGTCCTGGGTCTTAAGG + Intergenic
1036257670 8:7218575-7218597 TGCCAAGGTGCCTGGTCTTGGGG + Intergenic
1036258921 8:7225574-7225596 TGCCAAGGTGCCTGGTCTTGGGG + Intergenic
1036307701 8:7613936-7613958 TGCCGAGGTGCCTGGTCTTGCGG - Intergenic
1036309722 8:7677171-7677193 TGCCAAGGTGCCTGGTCTTGGGG + Intergenic
1036310973 8:7684170-7684192 TGCCGAGGTGCCTGGTCTTGCGG + Intergenic
1036358555 8:8061937-8061959 TGCCGAGGTGCCTGGTCTTGCGG - Intergenic
1036359814 8:8068948-8068970 TGCCAAGGTGCCTGGTCTTGGGG - Intergenic
1036645882 8:10611336-10611358 AGCCAGGGTGCGGGGTCTCGGGG - Exonic
1036829605 8:12011702-12011724 TGCCAAGGTGCCTGGTCTTGGGG + Intergenic
1036891144 8:12598022-12598044 TGCCAAGGTGCCTGGTCTTGGGG + Intergenic
1036892404 8:12605015-12605037 TGCCGAGGTGCCTGGTCTTGCGG + Intergenic
1038223831 8:25636262-25636284 TGCCATGATGCTTGGGTTTGGGG - Intergenic
1039615608 8:38952538-38952560 TTCCATGGGGCTGGGTCCTTGGG + Intronic
1040640961 8:49333964-49333986 TGCCATGCTCCTGTGTCTTCAGG - Intergenic
1040781873 8:51119116-51119138 TGCAATTGTGCTGTATCTTGTGG - Intergenic
1040830840 8:51675374-51675396 TGCCTTGTTGCTGTGTCTTCTGG - Intronic
1041123652 8:54612356-54612378 TGCCATGGGGCTGGGGGATGAGG + Intergenic
1044434595 8:92147280-92147302 AGCCACTGTCCTGGGTCTTGGGG + Intergenic
1047172520 8:122507875-122507897 TGCCATGTTGCTTGGCCTTATGG - Intergenic
1047568702 8:126074026-126074048 TGCAATCGTGCTGGGGGTTGGGG - Intergenic
1048245487 8:132792673-132792695 TGTCATGGTGCTAGGTCCTGGGG + Intronic
1049002854 8:139837321-139837343 TGCCACGGGGCAGGGTCTTCCGG + Intronic
1049604907 8:143524794-143524816 TGCCCTGCTGTGGGGTCTTGTGG - Intronic
1050010512 9:1181421-1181443 TGGCATGATGCTGAGTTTTGAGG + Intergenic
1052268113 9:26597236-26597258 GGCCCTTGAGCTGGGTCTTGAGG - Intergenic
1053160124 9:35808352-35808374 TGCCATGGTCCTGAGTCTAGGGG - Intronic
1053445460 9:38149899-38149921 TGCCAGGATGCTGGGACTCGGGG - Intergenic
1053863919 9:42415741-42415763 TGTCATGGTGTTGGATCTTTAGG - Intergenic
1054743618 9:68833049-68833071 TGGCATGGTGCTAGGCCTTAAGG + Intronic
1056750668 9:89348735-89348757 TGCCATGGGGCAGGGTCTCCTGG - Intronic
1056928372 9:90854055-90854077 TGACATGGTGCTGCCTCCTGGGG - Intronic
1057034979 9:91805362-91805384 TGCCATGAGGCTGTGTCTTGGGG - Intronic
1057349975 9:94288109-94288131 TGCTCTGGTGCTGGGTTATGAGG - Intronic
1059987145 9:119831345-119831367 TGGCATGGTCTTGGATCTTGGGG + Intergenic
1060516361 9:124268353-124268375 TGGCCTGGTGCTGGGTACTGGGG + Intronic
1060524187 9:124311315-124311337 TGGCATGGAGCTGGGTGATGTGG + Intronic
1060721322 9:125981142-125981164 TACCCTGGTGCTGGTTCTTGCGG + Intergenic
1061050060 9:128190095-128190117 GGCCATGGTGCTGGCTCTTTGGG - Intronic
1061447817 9:130651206-130651228 TGTCTTGGTCCTGGGTCTTGGGG - Intergenic
1061494153 9:130962160-130962182 AGGCATGGGGCTGAGTCTTGGGG + Intergenic
1062200459 9:135300155-135300177 GCCCAGGCTGCTGGGTCTTGTGG + Intergenic
1062629064 9:137455525-137455547 GGCCAGGGACCTGGGTCTTGAGG - Intronic
1203422375 Un_GL000195v1:5378-5400 TGCCAAGGTCCTGAGACTTGGGG + Intergenic
1185632075 X:1522531-1522553 TCCCAAGGTGCTGGGACTAGAGG - Intronic
1186438150 X:9561104-9561126 TGTCATGGTGATGGGTCATTGGG - Intronic
1186507643 X:10106120-10106142 TCCCATGGTGATGAGTCGTGAGG - Intronic
1188236818 X:27741417-27741439 AGCCATGGTGCTGGGGCATGGGG - Intronic
1190074091 X:47302948-47302970 TGACATGGTGCTGAGCCCTGTGG + Intergenic
1192148381 X:68696771-68696793 AGGCTTGGTGCTAGGTCTTGTGG + Intronic
1192229157 X:69252857-69252879 GGCCATGCCACTGGGTCTTGAGG - Intergenic
1192330704 X:70173149-70173171 TGTCCTGGTTCAGGGTCTTGGGG - Intergenic
1193903414 X:87212728-87212750 AGCCTTGTTGCTGTGTCTTGTGG + Intergenic
1194130365 X:90074028-90074050 TGTCAGGGTGTTGGGTGTTGGGG + Intergenic
1196215799 X:113050412-113050434 AGCCATGCTGCTGGGGGTTGTGG - Intergenic
1197639347 X:128950807-128950829 TGCCAAGGTCCTTGTTCTTGAGG - Intergenic
1197752390 X:129974373-129974395 TGCCAAGGTGGGAGGTCTTGGGG + Intergenic
1198446047 X:136715616-136715638 TGCCCTAGTGCTGGTTCCTGTGG - Intronic