ID: 903710904

View in Genome Browser
Species Human (GRCh38)
Location 1:25323412-25323434
Sequence GTAGTTCAGTGGTTGCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 2, 1: 0, 2: 3, 3: 29, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903710904_903710908 27 Left 903710904 1:25323412-25323434 CCCAAAGGCAACCACTGAACTAC 0: 2
1: 0
2: 3
3: 29
4: 205
Right 903710908 1:25323462-25323484 GTAATTTTTTTGTTTGAGACAGG 0: 2
1: 6
2: 184
3: 1477
4: 25577
903710904_903710907 -8 Left 903710904 1:25323412-25323434 CCCAAAGGCAACCACTGAACTAC 0: 2
1: 0
2: 3
3: 29
4: 205
Right 903710907 1:25323427-25323449 TGAACTACTTTCTGTCACTAAGG 0: 2
1: 2
2: 33
3: 238
4: 898
903710904_903710909 28 Left 903710904 1:25323412-25323434 CCCAAAGGCAACCACTGAACTAC 0: 2
1: 0
2: 3
3: 29
4: 205
Right 903710909 1:25323463-25323485 TAATTTTTTTGTTTGAGACAGGG 0: 2
1: 104
2: 754
3: 20555
4: 36610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903710904 Original CRISPR GTAGTTCAGTGGTTGCCTTT GGG (reversed) Intronic
900748233 1:4376097-4376119 GCAGAACAGTGGTTTCCTTTTGG + Intergenic
902081761 1:13825820-13825842 GTAGATCTGTGGTTGCCTAAGGG - Intergenic
903480054 1:23646438-23646460 GTAGTTAAGTGGTTGGTCTTTGG - Intergenic
903710904 1:25323412-25323434 GTAGTTCAGTGGTTGCCTTTGGG - Intronic
903716043 1:25368017-25368039 GTAGTTCAGTGGTTGCCTTTGGG + Intronic
906176309 1:43776232-43776254 GCAGATCAGTGGTTGCCCTAGGG - Intronic
907098308 1:51802495-51802517 CTAATTCAGTGGTTGTCATTTGG - Intronic
909648248 1:77941250-77941272 GTACTTCAGTTGTTGACTTTTGG - Intronic
910044009 1:82889994-82890016 GGAGTTCAGTGGTTTCCTGATGG - Intergenic
913132074 1:115849190-115849212 GTAGAACAGTGGTTTCCTGTGGG - Intergenic
913355707 1:117919524-117919546 GTAGATCAGTGGTTGCCCAGAGG + Intronic
914878316 1:151528823-151528845 GTAGATTAGTGGTTGCCATTGGG - Intronic
915608915 1:156974684-156974706 GTAGATCAGTGGTTGCCAGAGGG - Intronic
916105332 1:161425845-161425867 GCAGATCAGTGGTTGGCTTGGGG + Intergenic
917932230 1:179830622-179830644 GTAGTGCAGTGGTGTGCTTTCGG - Intergenic
919147458 1:193653897-193653919 GAAGTTCAGTAGTAGCCTTATGG + Intergenic
919191592 1:194228093-194228115 CTAGTTCAGAGGTTGCCAATTGG - Intergenic
920203111 1:204272650-204272672 TTGGGTCAGTGGTTGCCTCTAGG - Intronic
921075252 1:211695407-211695429 GTAGTCCAGTGGTTCAGTTTTGG - Intergenic
921340272 1:214127762-214127784 GTAGTTCTGTGTTTGAATTTGGG - Intergenic
921790568 1:219285686-219285708 GTAGATCAGTCGTTGCCTTAGGG + Intergenic
922386928 1:225095804-225095826 GTAGATCAGTGGTTGCCTGGTGG + Intronic
922845816 1:228683192-228683214 TTAGGTCAGTGGCTGCCTATGGG - Intergenic
922979083 1:229809763-229809785 GTAGATTAGTGGTTGCCTTTGGG - Intergenic
923174399 1:231449450-231449472 ATAGTTCTGTGGTTCCCTTTTGG - Intergenic
924265635 1:242279028-242279050 GGAGCTCAGTGATTGCTTTTTGG - Intronic
924943922 1:248832086-248832108 GCAGATCAGTGGTTGCCTGGTGG + Intergenic
1063264097 10:4426514-4426536 CTACTTCAGTAGTCGCCTTTTGG - Intergenic
1063984945 10:11492262-11492284 GGACTGCAGTGGTTGGCTTTGGG + Intronic
1064782104 10:18853374-18853396 GCAGATCAGTGGTTGCCTGGGGG + Intergenic
1066719207 10:38319624-38319646 GGAGCTCAGTGATTGCTTTTTGG + Intergenic
1067383991 10:45802315-45802337 GTAGATTAGTGGTTGCCCTAGGG + Intergenic
1069152982 10:64988873-64988895 TTCATTCAGTGGGTGCCTTTAGG - Intergenic
1070496234 10:77026202-77026224 GTCTTTCACTTGTTGCCTTTTGG - Intronic
1071073393 10:81722894-81722916 GTGGATCAGTGCTTGCCTATGGG + Intergenic
1075214514 10:120520387-120520409 CTATTTCAGAGGTTGCCTCTGGG - Intronic
1079171631 11:18101965-18101987 GCAGATCAGTGGTTGCCTGGAGG + Intronic
1080448549 11:32359486-32359508 TGAGCTCAGTGGCTGCCTTTAGG + Intergenic
1081644738 11:44781859-44781881 GCAGACCAGTGGTTGCCTCTGGG - Intronic
1082919441 11:58476898-58476920 GTAGATTAGTGGTTGCCTACGGG + Intergenic
1084547297 11:69820779-69820801 GTAGTTCAGTGGCTGGCCTCTGG - Intergenic
1085158266 11:74316354-74316376 GTAGATTAGTGGTTGCCATGAGG - Intergenic
1085497269 11:76981558-76981580 GTAGATCAGTGGTGGCCTGGAGG - Intronic
1086877595 11:92115207-92115229 GTAGTTTTGAGGTTTCCTTTTGG - Intergenic
1087012763 11:93529344-93529366 GTGTTTCAGGAGTTGCCTTTGGG - Intronic
1089162461 11:116449886-116449908 GCAGATCAGTGATTGCCTATGGG + Intergenic
1089369199 11:117942121-117942143 GTAGATTCGTGGTTGCCTTAGGG - Intergenic
1089594625 11:119569572-119569594 GTAGACCAGTGGTTGCCTAGAGG - Intergenic
1089864153 11:121617112-121617134 GTCTTTTAGTGGCTGCCTTTAGG + Intronic
1093750147 12:22788886-22788908 GCAGATCAGTGGTTGCCTAAGGG - Intergenic
1094246448 12:28301182-28301204 TTAGTTAAGTTGCTGCCTTTAGG + Intronic
1098258973 12:68647721-68647743 GTTGTTGATTGGTTGGCTTTGGG + Intronic
1100650256 12:96579610-96579632 GTAGTTTAGGAGTTGCCTCTGGG + Intronic
1102319860 12:111923486-111923508 GTAGTACAGTGGTGCCATTTTGG + Intergenic
1103388719 12:120554452-120554474 TTAGTTCAAGGGATGCCTTTGGG + Intronic
1104220537 12:126780116-126780138 GTAGTTTGATGTTTGCCTTTAGG - Intergenic
1105330647 13:19412377-19412399 GTAGTCCAGGGTTTCCCTTTGGG - Intergenic
1105918718 13:24941152-24941174 GTAGTCCAGGGTTTCCCTTTGGG - Intergenic
1106704173 13:32262908-32262930 TTGATTCAGTGCTTGCCTTTTGG + Intronic
1107379788 13:39844821-39844843 GAAGTTGAGTGATTGTCTTTTGG + Intergenic
1107482238 13:40794673-40794695 GTAGTCCAGGGTTTTCCTTTGGG - Intronic
1107914791 13:45138398-45138420 GTAGGTCAGTGGTTGATTCTGGG - Intronic
1109408799 13:61937366-61937388 GAAGATCAGTGGTTGGCTTCTGG - Intergenic
1111958218 13:94781189-94781211 ACAGTTCAGAGGGTGCCTTTGGG + Intergenic
1112256327 13:97835098-97835120 GTAGAGCAGTGGTTGCCTGAAGG - Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112662497 13:101527270-101527292 GTAGCTCAGTGGTTGCCTATGGG - Intronic
1114507326 14:23227355-23227377 GCAGGACAATGGTTGCCTTTAGG + Intronic
1115256481 14:31408003-31408025 TTAGTTCAGTTATTGGCTTTAGG - Intronic
1117923390 14:60749340-60749362 GTAGTTCATTAGTTTCCTTTAGG + Intronic
1118445305 14:65845402-65845424 TCAGTAAAGTGGTTGCCTTTGGG - Intergenic
1119353157 14:73983059-73983081 GTAGTCCTGCTGTTGCCTTTAGG + Exonic
1119834574 14:77736790-77736812 GTAGATAGGTGGTTGCCTCTGGG - Intronic
1120961972 14:90133351-90133373 GTAGATTAGTGGTTGCCTATGGG + Intronic
1121086816 14:91153004-91153026 GAAGTTCAGTGGATGCTTCTTGG + Intronic
1122487704 14:102092580-102092602 GCAGATCACTGGTTGCCTGTAGG + Intronic
1123798333 15:23796434-23796456 GTATGTAAGTGGTTGCCTGTTGG + Intergenic
1123839051 15:24227616-24227638 CTATTTTAGTGGTTGCCTTATGG + Intergenic
1127133297 15:55891066-55891088 GTTGTTCATTGGTTGTCTTTGGG + Intronic
1128287029 15:66445787-66445809 GTAGATCAGTGGTTGCCTTGAGG + Intronic
1130840525 15:87695939-87695961 ATAGATTAGTGGTTGCCTTGGGG - Intergenic
1131972396 15:97905433-97905455 ACAGCTCAGTGGTTGCCTCTGGG + Intergenic
1134780808 16:16893546-16893568 GTAGATTAGTGGTTGCCTAGGGG - Intergenic
1135742641 16:24989569-24989591 GTAGATGAGTGGTTGGCTTTGGG + Intronic
1137311902 16:47270877-47270899 GCAGATCAGTGGTTTCCTGTGGG + Intronic
1137563902 16:49521590-49521612 CTAGCTCAGTGGTGGCCTTTTGG + Intronic
1138316002 16:56070922-56070944 CTAGTTAAGTGGTGGCATTTAGG - Intergenic
1138715678 16:59019189-59019211 TTATTTTAGTGGTTGCCTTAGGG - Intergenic
1139532898 16:67552005-67552027 GTAGATTAGTGGTTGCCTGGGGG - Intergenic
1141114370 16:81295724-81295746 TGATTTCAGTGGTTTCCTTTTGG - Intergenic
1143745067 17:8987412-8987434 GCAGGTCAGTGGTTGCCTAGAGG - Intergenic
1143963650 17:10740481-10740503 TTAGGTCAGTAGTTGCCTTTGGG + Intergenic
1145952423 17:28829491-28829513 ACAGATCAGTGATTGCCTTTGGG - Intronic
1147059852 17:37866729-37866751 GTAGTGCAGTGGTTCACTCTTGG - Intergenic
1148409119 17:47449220-47449242 GTAGTGCAGTGGTTCACTCTTGG - Intergenic
1149492557 17:57095646-57095668 GTAGTTCACTGTCTGCCATTAGG + Intronic
1149640961 17:58202221-58202243 GTAGTTCAATGGATGACGTTGGG + Intronic
1151254479 17:72865160-72865182 CCAGTTCAGAGGTTGCCTTGGGG + Intronic
1155978874 18:32160308-32160330 GTGGTTCAGTGCTTAGCTTTTGG - Intronic
1156258543 18:35422815-35422837 GTGGTTTAGTGGTGGCTTTTAGG + Intergenic
1157825967 18:50812912-50812934 GTAGTTCAGTGACTGCCTGCTGG - Intronic
1159519112 18:69495763-69495785 GTAGTTCAGTGCTGGCCTGCAGG - Intronic
1159889743 18:73942457-73942479 TTAGTGCAGTTGCTGCCTTTAGG - Intergenic
1160055678 18:75477675-75477697 GTGATTCAGTGTTTGCATTTGGG - Intergenic
1162426473 19:10599652-10599674 ATATATCAGTGGTTGACTTTTGG - Intergenic
1165198852 19:34129145-34129167 CTTGTTCAGTGGTTACCCTTGGG - Intergenic
1166626659 19:44363467-44363489 GTAGAACAGTGGTTGCCACTGGG - Intronic
1168672624 19:58252573-58252595 GTAGTTCAGAGGTTGTCTAAAGG - Intronic
926067704 2:9857507-9857529 GAAGGTCAGTGGTTCCATTTTGG + Intronic
927052894 2:19347947-19347969 GGAGTTCAGTGTTTTGCTTTTGG - Intergenic
927082653 2:19645859-19645881 GGAATTCAGTGGTAGACTTTCGG - Intergenic
927136843 2:20103439-20103461 TTTATTCATTGGTTGCCTTTGGG - Intergenic
927735502 2:25517253-25517275 GTAGTTTGGTGATTGCCTTAGGG + Intronic
935037830 2:99396267-99396289 GTAGTTATGTAGTGGCCTTTTGG + Intronic
935423710 2:102897549-102897571 GGACTTCAGTGTTTGACTTTTGG + Intergenic
935600315 2:104915679-104915701 GAAGATCAGTGGTTGGCTTGAGG - Intergenic
936257802 2:110932230-110932252 ACAGTTCAGTGGTTGCCTTGGGG + Intronic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
941170959 2:162135353-162135375 ATAGTTTAATGGTTGCCTCTGGG - Intergenic
941789888 2:169540322-169540344 ATGGTTAAGTGGTTACCTTTGGG + Intronic
943059294 2:183021756-183021778 GTACATCAGTGGTTGCCTTAGGG + Intronic
944025415 2:195160222-195160244 TGAGGACAGTGGTTGCCTTTGGG + Intergenic
945749699 2:213766213-213766235 GTAGTTTAGTGGTTACCCTCAGG + Intronic
947262323 2:228237468-228237490 GTAGTTCTGTGGTTAGTTTTTGG + Intergenic
947547594 2:231021620-231021642 GAAGTTCTGTTTTTGCCTTTAGG - Exonic
1169026161 20:2373388-2373410 TCAGAACAGTGGTTGCCTTTGGG - Intergenic
1169390608 20:5187398-5187420 GTAGTACAGTGCTTGCCTAAAGG + Intronic
1171874250 20:30557564-30557586 GGAGTGCAGTGGTTCCATTTTGG + Intergenic
1175320491 20:58084367-58084389 ATAGTACAGCGGTTGCCTCTTGG + Intergenic
1175412976 20:58783744-58783766 CTCGTTCAGTGGTGGCCCTTAGG - Intergenic
1176082096 20:63278656-63278678 GTACTTCTGTGGCTGGCTTTGGG + Intronic
1176742364 21:10616250-10616272 GTAGTCCAGGGTTTCCCTTTGGG + Intergenic
1180239401 21:46490253-46490275 GTAATTCAGAGGTGGGCTTTGGG + Intronic
1180564243 22:16649459-16649481 GTAGTCCAGGGTTTCCCTTTGGG + Intergenic
1180682973 22:17641715-17641737 GTAGATCAGTGGTTGCCCAAGGG - Intronic
1181972870 22:26706215-26706237 TCAGATCAGTGGTTGCTTTTAGG - Intergenic
1182175293 22:28279798-28279820 TCAGATCAGTGGTTGTCTTTGGG - Intronic
1182876069 22:33692004-33692026 TTGGTTCCGTGGTAGCCTTTTGG - Intronic
952422776 3:33146287-33146309 GGAGCTCAGTGGTTGCTGTTTGG + Exonic
958964552 3:100544535-100544557 GCAGATCAGTGGTTGCCTCCAGG - Intronic
961132348 3:124480723-124480745 GTAGATCATTGGTTGCTTGTGGG - Intronic
961462978 3:127064623-127064645 TCAGTTCAGTGGGTGCCTTGTGG + Intergenic
962418528 3:135206050-135206072 TTAGAACAGTGGTTGCCTCTGGG - Intronic
963262590 3:143207693-143207715 GTAGGTAAGTAGTTGCCTTCTGG + Intergenic
963867458 3:150378156-150378178 TTAGTTCAGAGGTTGCCTGTAGG + Intergenic
964659816 3:159107682-159107704 TTAGCTCATTGGTTGCCCTTAGG - Intronic
965696918 3:171418650-171418672 GTAGATTAGTGGTTGCTTTAGGG + Intronic
966569368 3:181423922-181423944 GGAGTTCAGTGGTGCCATTTTGG - Intergenic
967213617 3:187191426-187191448 GAAGTTCAATGGTTGCTGTTGGG + Intergenic
970081041 4:12286039-12286061 GCAGTTCAGTGTTTCCCTATAGG + Intergenic
972917757 4:43902277-43902299 ATTGTTCAGTAGTTTCCTTTAGG + Intergenic
973843126 4:54882818-54882840 TTAGAACAGTGGTTGCCTGTAGG - Intergenic
974084110 4:57241183-57241205 TTAGTTCAGTTCTTCCCTTTTGG - Intergenic
975679782 4:76865277-76865299 GTAGATTAGTGGTTGCCTAGGGG - Intergenic
975787964 4:77913932-77913954 GCAGACCAGTGGTTGCCTTGGGG + Intronic
975978894 4:80132800-80132822 TCAGATCAGTGGTTGCCTCTGGG + Intergenic
976592309 4:86861203-86861225 GCAGATCAGTGGTTGCCTAGAGG + Intergenic
978114502 4:105003236-105003258 GGAATGCAGTTGTTGCCTTTGGG + Intergenic
982721191 4:158861868-158861890 GTAATTCATAGGTTGTCTTTGGG + Intronic
984022154 4:174498515-174498537 GCAGATCAGTGGTTGCCTGTGGG - Intronic
987057486 5:14208475-14208497 GCATTTCAGTGGTTGCCTTGGGG + Intronic
987361603 5:17112164-17112186 GCAGCTCAGTGGTTGGCTTTGGG + Intronic
989073571 5:37537950-37537972 TTAGTTCAGTGAGGGCCTTTGGG + Intronic
990643900 5:57821874-57821896 GTATTTTAGTGGTTGCCTTAGGG + Intergenic
990981003 5:61602432-61602454 GTAGTTGAGTTTTTGCCTTAGGG + Intergenic
991478400 5:67049122-67049144 TTCTTTCAGTAGTTGCCTTTTGG + Intronic
991954472 5:71978768-71978790 GCAGTTCTGTGGTTGCCTATAGG - Intergenic
992696841 5:79297691-79297713 ATAGGTCAGTGGTGGACTTTGGG - Intronic
992764583 5:79985522-79985544 ATAGTTCAGTATTTTCCTTTCGG - Intronic
993179644 5:84535615-84535637 GCAGGTCAGTGGTTGCCTGGAGG + Intergenic
995095515 5:108231341-108231363 GCAGATCAGTAGTTGCCTGTGGG - Intronic
995240060 5:109875447-109875469 GTAGATCTGTGGCTGCCTTATGG + Intergenic
996316627 5:122167820-122167842 GTAGATTAGTGGTTGCCTGGAGG - Intronic
996347268 5:122500626-122500648 GTAGCTCAGAGGTTGCCGTGAGG - Intergenic
996945551 5:129063072-129063094 GTATATCAGTGGTTGGCTTCAGG - Intergenic
999575151 5:152967978-152968000 GTAGTTTAATGGGTACCTTTTGG - Intergenic
999786298 5:154893617-154893639 CCAGTTCAGTGGTTGCCAGTGGG - Intronic
999786339 5:154893993-154894015 GTAGTGCAGTGGTTCCATCTTGG + Intronic
999876871 5:155816930-155816952 GTTGTGCAGTAGTTGCATTTAGG - Intergenic
1000633625 5:163618578-163618600 GTAGAATAGTGGTTACCTTTGGG - Intergenic
1001325071 5:170717933-170717955 GTAGGTGAGTGATTTCCTTTGGG - Intronic
1002112272 5:176925740-176925762 ATAAAACAGTGGTTGCCTTTAGG + Intronic
1002348251 5:178563080-178563102 GTACTCCAGGGGGTGCCTTTAGG + Intronic
1002821261 6:727136-727158 GGAGTGCAGTGGTTCCCTCTAGG + Intergenic
1003217833 6:4131286-4131308 CTAATTCAGTGGTGGACTTTTGG + Intronic
1004313471 6:14565897-14565919 GTGGTTCAGTGAGTCCCTTTGGG - Intergenic
1007233124 6:40365038-40365060 CTATTTCAGTGGTTGCTTTAGGG - Intergenic
1008573262 6:52835191-52835213 GTAGATTAGTGGTTGCCTGGAGG - Intronic
1010657216 6:78525778-78525800 CCAGTTCTGTGCTTGCCTTTTGG - Intergenic
1011471635 6:87713781-87713803 GGAGTTCAGTGGTCCCATTTTGG + Intergenic
1011658279 6:89571586-89571608 CTCATTCTGTGGTTGCCTTTAGG + Intronic
1012236095 6:96817803-96817825 GTAGTTTATTGGTTACCTTTGGG + Intronic
1012849150 6:104426075-104426097 GTAGTTCAGAGGTAGGCTCTAGG - Intergenic
1013048205 6:106508502-106508524 GTAGGTCGGTGGTTGCCTGAGGG - Intergenic
1016055698 6:139575701-139575723 GTAGTTCTGTGTTTGTCTTTAGG + Intergenic
1017294182 6:152775296-152775318 TTAGTGCAGTGGTTACCCTTGGG - Intergenic
1017745853 6:157446458-157446480 GGAGTGCAGTGGTTGAATTTCGG + Intronic
1018054200 6:160037759-160037781 TTAGTTCAGTGCTAGTCTTTGGG + Intronic
1019569826 7:1705692-1705714 GCAATTCAGTGGATGGCTTTGGG + Intronic
1021194104 7:17655195-17655217 GCAGTTCAGAAATTGCCTTTAGG - Intergenic
1022213616 7:28236431-28236453 GGAGTGCAGTGGTGCCCTTTTGG + Intergenic
1023979524 7:45059768-45059790 TTATTTTAGTGGTTGCCTTAGGG + Intronic
1025908299 7:65806919-65806941 ATAGATCAGTGGTTGCCTATGGG - Intergenic
1025980785 7:66403792-66403814 ATAGATCAGTGGTTGCCTATGGG + Intronic
1027205673 7:76096163-76096185 ATAGATCAGTGGTTGCCTATTGG + Intergenic
1028851909 7:95547310-95547332 ACAGTACAGTGGTTGCCTGTGGG - Intergenic
1030444661 7:109634169-109634191 AAAGTACAGTGGTTGCCTATGGG - Intergenic
1030821861 7:114102955-114102977 GTTGTTCAGTGCTTGACTTTTGG + Intronic
1030996237 7:116361782-116361804 GTACTTCACTGGTGGTCTTTTGG - Intronic
1033804422 7:144937697-144937719 GGAGTGCAGTGGTGGGCTTTAGG + Intergenic
1033932617 7:146543113-146543135 ATAGTGCAATGGTTGCATTTGGG - Intronic
1039410481 8:37350990-37351012 GTATTTCAGAGTTTGGCTTTAGG + Intergenic
1040039875 8:42905264-42905286 GTAGTTCAGTTTTTACCTTTAGG + Intronic
1042662996 8:71176456-71176478 GTAAATCAGCAGTTGCCTTTAGG - Intergenic
1043091846 8:75914193-75914215 GGAGTTCAGTGGTGCCCTCTTGG + Intergenic
1044342572 8:91064129-91064151 TTAGTGCAGAGGTTGCCATTGGG + Intergenic
1044523957 8:93230387-93230409 GTAGATCAGTGGATGTCATTGGG + Intergenic
1048536317 8:135299214-135299236 TTAGAACACTGGTTGCCTTTAGG + Intergenic
1048815719 8:138332002-138332024 GTAGTTCAGTCTTTTCATTTGGG - Intronic
1049487851 8:142875746-142875768 GCAGCTCGGTGGTTGCCTTCTGG + Exonic
1049492628 8:142913319-142913341 GCAGCTCGGTGGTTGCCTTCTGG + Exonic
1050762290 9:9087428-9087450 GGAGTACAGTGGCTGCCTTCCGG - Intronic
1051393498 9:16592504-16592526 GTAGATTAGTGGCTGCCTTGTGG + Intronic
1051558815 9:18416312-18416334 TTAGTTTAGTGGTTGCTTTAGGG - Intergenic
1055680284 9:78707509-78707531 GTATAAAAGTGGTTGCCTTTGGG - Intergenic
1056141926 9:83690251-83690273 GTAGTTCATTTGTTGTCATTGGG - Intronic
1057756713 9:97844715-97844737 GTAGTTCAGTGATTGCTTATGGG + Intergenic
1058928130 9:109689109-109689131 CGAGTTCAGTGGTTGACTCTGGG + Intronic
1060112444 9:120916264-120916286 GTAGATCAGTGGTTGCCTCCTGG + Intronic
1060757062 9:126222039-126222061 TCAGAGCAGTGGTTGCCTTTGGG + Intergenic
1061254951 9:129449643-129449665 GTAGTTCAGTCGCTGCCTCCTGG - Intergenic
1061951423 9:133938424-133938446 GTAGTTCATTGGTGGCCTCCTGG - Intronic
1186010863 X:5131412-5131434 GGAGTTCAGTGGTGCACTTTCGG + Intergenic
1186545458 X:10444530-10444552 GTAGTTCAGTAGTTGCCATAGGG + Intergenic
1188223580 X:27570230-27570252 GTAGTTCAATGGTATCTTTTGGG + Intergenic
1196131033 X:112156555-112156577 GTGGTTAAGTGGTTGAGTTTTGG + Intergenic
1197730936 X:129809532-129809554 GTAGATTAGTGGTTGCCTAGGGG + Intronic
1200313343 X:155102855-155102877 TTATTTCAGTGGTTGCTTTAGGG + Intronic
1202600680 Y:26590432-26590454 GTAGTCCAGGGTTTCCCTTTGGG + Intergenic