ID: 903712815

View in Genome Browser
Species Human (GRCh38)
Location 1:25338480-25338502
Sequence GGTAAGAGAGTAGCGGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903712804_903712815 22 Left 903712804 1:25338435-25338457 CCACTGCACGACGGGGCTGGACG 0: 1
1: 0
2: 1
3: 2
4: 46
Right 903712815 1:25338480-25338502 GGTAAGAGAGTAGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 62
903712802_903712815 28 Left 903712802 1:25338429-25338451 CCGGAACCACTGCACGACGGGGC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 903712815 1:25338480-25338502 GGTAAGAGAGTAGCGGCCGCAGG 0: 1
1: 0
2: 0
3: 2
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903712815 Original CRISPR GGTAAGAGAGTAGCGGCCGC AGG Intronic
902220447 1:14961171-14961193 GGTAAGAGAGACTCGGCTGCTGG - Intronic
903712815 1:25338480-25338502 GGTAAGAGAGTAGCGGCCGCAGG + Intronic
906491279 1:46270741-46270763 GCTAGGAGAGGAGCGGCTGCGGG + Exonic
911078843 1:93908951-93908973 GGCAAGGGAGAAGCGCCCGCGGG - Intronic
912682644 1:111739052-111739074 GGGAAGAGAGGAGAGGACGCGGG - Intronic
912682687 1:111739164-111739186 GGTAAGAGCGAAGCTGGCGCCGG - Exonic
915030360 1:152874713-152874735 GGTAGGAGTGTGGCTGCCGCGGG + Intergenic
921367907 1:214392031-214392053 GGTCAGAGAGTATCGCCCTCTGG + Intronic
1064060082 10:12129790-12129812 GGGCAGTGAGTAGCGGCGGCTGG + Exonic
1065188707 10:23192355-23192377 GGCCAGAGCGCAGCGGCCGCGGG + Exonic
1069694123 10:70374282-70374304 GGCAAGAGTGGAGAGGCCGCAGG - Intronic
1071164671 10:82791578-82791600 GGTGAGAGAGTAGGGCCTGCTGG + Intronic
1078375905 11:10792770-10792792 GGGCAGAGAGTAGCGGACACAGG - Intergenic
1078731532 11:13979499-13979521 AGTAAGAGAGTAGGGGAAGCAGG + Intronic
1088459276 11:110065356-110065378 GGTAAGGGAGTGGCAGCTGCAGG - Intergenic
1101975163 12:109351324-109351346 GGTAAGATAGTAGAGGCTGATGG - Intronic
1106138202 13:26990282-26990304 GGTGAGAGAGGAGTGGCTGCAGG - Intergenic
1108131110 13:47301270-47301292 GGTAAGAGAGTAGAGGCTCATGG + Intergenic
1124196153 15:27631700-27631722 GGTGTGAGGGGAGCGGCCGCTGG - Intergenic
1134624021 16:15711151-15711173 GGGAAGAGAGCAGCTGGCGCAGG - Intronic
1139596610 16:67961908-67961930 GGGTAGAGAGAAGCAGCCGCGGG - Intronic
1148166954 17:45490480-45490502 GGTCGGAGAGGAGCGGGCGCGGG + Intronic
1149612393 17:57967145-57967167 GGTAAGTGAGGAGGGCCCGCAGG - Intergenic
1150453895 17:65291871-65291893 GGTAAGAGAGAGGCAGCCCCAGG - Intergenic
1152012180 17:77725380-77725402 GGTAAGCCAGGAGCGGCGGCAGG - Intergenic
1154133068 18:11752334-11752356 GGAAAGAGAGGAGCCGTCGCAGG + Intronic
1164451416 19:28368831-28368853 GGAAAGAGAGTAGCGGCTCAAGG - Intergenic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
928614806 2:33026950-33026972 GTTAAGAGAGTAGCTCCCTCCGG - Intronic
938768903 2:134483055-134483077 GGTAAGGCAGCAGCGGCCGAGGG + Intronic
941037612 2:160585170-160585192 GGCAAGAGAGTAGAGGCCCCTGG - Intergenic
942948823 2:181699844-181699866 GGTAAGAGAGTGGCGTGCACCGG + Intergenic
1178358757 21:31931252-31931274 GGTAAGAGAGAAGGGGCCCAGGG - Intronic
1182780161 22:32861264-32861286 GGGAAGAGAGTACCGGCATCGGG + Exonic
1183281223 22:36933696-36933718 GGTGAGAGAGAAGCCGCAGCAGG + Intronic
949861277 3:8507076-8507098 GGTGAGACAGTAGCAGCTGCTGG - Intronic
963070983 3:141305121-141305143 CGTAACAGAGTAGGGGGCGCAGG - Intergenic
971156754 4:24091567-24091589 GGAGAGAGAGTAACAGCCGCTGG - Intergenic
979660274 4:123245250-123245272 GGTAAGGGAGTAGTGGCAGTGGG - Intronic
985687247 5:1289160-1289182 GGTGAGTGAGTTGCGGCCCCCGG - Intronic
985765899 5:1779482-1779504 CATAAAAGCGTAGCGGCCGCAGG + Intergenic
986171706 5:5319675-5319697 GGTAAGAGATGCTCGGCCGCTGG - Exonic
1002029332 5:176416430-176416452 GGTGACAGCGTCGCGGCCGCCGG - Exonic
1004165435 6:13252691-13252713 TGTGAAAGAGTATCGGCCGCAGG + Intronic
1004492392 6:16129159-16129181 GGGACGCGAGTGGCGGCCGCGGG + Exonic
1006173734 6:32109648-32109670 GGTCAGAGAGGAGGGGCAGCAGG - Intronic
1007718136 6:43869313-43869335 GGTAAGAGAGAAGAGGCTTCTGG - Intergenic
1013430050 6:110047655-110047677 GGTACAAGAGTAGCTGCAGCTGG + Intergenic
1022359466 7:29644363-29644385 GGTAAGAGAGTAGCCACGGAGGG + Intergenic
1023967021 7:44968024-44968046 GGGAAGAGAGTGGGGGCTGCTGG - Intronic
1025943829 7:66091890-66091912 GGTAAGAGAGTATCTGCCCAAGG + Intronic
1029449560 7:100633276-100633298 GGTCGGAGAGCAGCTGCCGCTGG - Exonic
1032631082 7:133652665-133652687 GGGAAGAGAGAAGCAGCCACAGG + Intronic
1035254643 7:157618563-157618585 GTGAAGAGCGCAGCGGCCGCAGG + Exonic
1039548382 8:38426100-38426122 GGTAAGAGGGCAGAGGCAGCAGG - Exonic
1042560372 8:70069379-70069401 GGTAACAGAGAAGCATCCGCAGG + Exonic
1049192309 8:141295142-141295164 GGTCAGAGAGGAGCTGCCACAGG + Intronic
1051149596 9:14066104-14066126 GGTAAGCAAGTAGCAGCCCCTGG - Intergenic
1051787147 9:20757699-20757721 GGAAAGAGAGCAGCGGTAGCAGG + Intronic
1053142645 9:35690842-35690864 GGAAAGAGAGGAGCGTCCGCGGG - Exonic
1053203929 9:36170900-36170922 GGAAAGAGAGCAGGGGCCGATGG - Exonic
1185685840 X:1927689-1927711 GGTAAGAGAAGAGCGGTCACTGG + Intergenic
1187584215 X:20641863-20641885 GGTAAGAGACTAGAGGCCAATGG - Intergenic
1192527447 X:71859809-71859831 GGGAAGCTAGTAGCGGCGGCTGG - Intergenic
1197804541 X:130386346-130386368 GGTCAGTGAGTAGTGGCTGCTGG + Intergenic