ID: 903715054

View in Genome Browser
Species Human (GRCh38)
Location 1:25359183-25359205
Sequence GGCTCATCTAAGGCACCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903715050_903715054 9 Left 903715050 1:25359151-25359173 CCATAGAGCATGCAGGCAGGCGT 0: 1
1: 1
2: 1
3: 9
4: 107
Right 903715054 1:25359183-25359205 GGCTCATCTAAGGCACCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
903715049_903715054 10 Left 903715049 1:25359150-25359172 CCCATAGAGCATGCAGGCAGGCG 0: 1
1: 2
2: 1
3: 9
4: 74
Right 903715054 1:25359183-25359205 GGCTCATCTAAGGCACCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
903715048_903715054 11 Left 903715048 1:25359149-25359171 CCCCATAGAGCATGCAGGCAGGC 0: 3
1: 0
2: 1
3: 21
4: 164
Right 903715054 1:25359183-25359205 GGCTCATCTAAGGCACCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903715054 Original CRISPR GGCTCATCTAAGGCACCTGT GGG Intronic
901780186 1:11588977-11588999 GCCTTATCTAAGGCCCCTTTGGG + Intergenic
903367875 1:22816113-22816135 ATCTCATCTCAGGCATCTGTCGG + Intronic
903569484 1:24293863-24293885 GGCTCCTCTAAGGGCCCTGCTGG + Intergenic
903715054 1:25359183-25359205 GGCTCATCTAAGGCACCTGTGGG + Intronic
904147272 1:28403257-28403279 GGGTCCACTAAGGCTCCTGTTGG - Intronic
904329962 1:29752435-29752457 GGCTCAGCTAGGGCACCTTATGG - Intergenic
912750297 1:112282094-112282116 CTCTCATCTGAAGCACCTGTTGG + Intergenic
919731311 1:200915318-200915340 GGCCCATCAAAGGAACCTGGGGG + Intronic
1065935173 10:30514898-30514920 GGCTCATTTAAGGTACTTGGTGG - Intergenic
1069522048 10:69130218-69130240 GGCTCATCTAAGGCAGCGTATGG - Intronic
1071505522 10:86229277-86229299 GGAGCAGCTAAGGCACCTGCTGG + Intronic
1077421063 11:2450210-2450232 ATCTCATCTCAGGCATCTGTGGG + Intronic
1081173821 11:39901509-39901531 GGCTCATTTAAGGAAACGGTAGG - Intergenic
1082023466 11:47553455-47553477 GGGTCATCTAGAGCTCCTGTGGG - Intronic
1083223711 11:61270242-61270264 GGCTCATCGAAGGCACTAGAAGG + Intronic
1083899484 11:65636683-65636705 ATCTCAGGTAAGGCACCTGTGGG + Exonic
1084605752 11:70170729-70170751 AGCTCATCTAATGCATCTGCAGG + Intronic
1085809322 11:79666429-79666451 GCCTTATCTAAACCACCTGTTGG - Intergenic
1090392479 11:126398114-126398136 GTCTCATCTAAGTCAGCTGTGGG + Intronic
1091323019 11:134665020-134665042 GGCGCAGCTCAGGCAGCTGTGGG - Intergenic
1093201475 12:16191987-16192009 AGCTCTTCTATGGCACCTGGAGG + Intronic
1093643323 12:21553542-21553564 TGCCCATTAAAGGCACCTGTTGG - Intronic
1099632938 12:85173961-85173983 GACTCATGTAAGTCACCTTTAGG + Intronic
1103891431 12:124241853-124241875 GGTCCATCAAGGGCACCTGTGGG - Intronic
1108589173 13:51896915-51896937 TGCTCATCTAAATCACCTGTGGG - Intergenic
1113052442 13:106228936-106228958 GGATTAGCTAAGGCACATGTTGG + Intergenic
1115436656 14:33382600-33382622 GGCTCATCAAATGCAGCTTTGGG + Intronic
1116876641 14:50118747-50118769 GGCCCATCAAATGCACCAGTAGG + Exonic
1119526512 14:75326987-75327009 GGCTCCTCTAAGGCTCCTCATGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1123467695 15:20528765-20528787 GGCATGTCTAAGGCAGCTGTGGG - Intergenic
1123650418 15:22472277-22472299 GGCATGTCTAAGGCAGCTGTGGG + Intergenic
1123728007 15:23123974-23123996 GGCATGTCTAAGGCAGCTGTGGG - Intergenic
1123740826 15:23281119-23281141 GGCATGTCTAAGGCAGCTGTGGG + Intergenic
1123746172 15:23321439-23321461 GGCATGTCTAAGGCAGCTGTGGG - Intergenic
1123761690 15:23438352-23438374 GGCATGTCTAAGGCAGCTGTGGG - Intergenic
1124278439 15:28344756-28344778 GGCATGTCTAAGGCAGCTGTGGG - Intergenic
1124304261 15:28566852-28566874 GGCATGTCTAAGGCAGCTGTGGG + Intergenic
1124533135 15:30523320-30523342 GGCATGTCTAAGGCAGCTGTGGG + Intergenic
1124765521 15:32484324-32484346 GGCATGTCTAAGGCAGCTGTGGG - Intergenic
1125043552 15:35220934-35220956 GTCTCATCTAAATCATCTGTGGG + Intronic
1125884564 15:43219007-43219029 GGCACATCTGAGGCAGCTCTGGG - Intronic
1131812358 15:96185693-96185715 GCCTCATCTAAGCCACCTCAGGG + Intergenic
1135550288 16:23392413-23392435 GGCTCAGCTCAGGGATCTGTAGG + Exonic
1136485697 16:30570585-30570607 GGCTCAGATAAGGCACTTTTAGG - Intronic
1137705840 16:50535317-50535339 GGCTCATGTAAGCCAGGTGTTGG - Intergenic
1138008386 16:53357451-53357473 GGCATGTCTAAGGCAGCTGTGGG - Intergenic
1139892920 16:70265628-70265650 GGCTCCTCTATGACACCTATGGG - Exonic
1142883198 17:2896786-2896808 TCCTCATCTAATGCACCTGGAGG + Intronic
1150264740 17:63824960-63824982 GGCCCTTCTAAGGTACCTGTAGG + Intronic
1153485383 18:5592789-5592811 GCATCATCTTAGGGACCTGTGGG + Intronic
1154219417 18:12439058-12439080 GGCTCATCTCTGGATCCTGTTGG - Intergenic
1156437971 18:37154013-37154035 GGATTCTCTAAGGCACCTGTAGG - Intronic
1158873597 18:61711813-61711835 GAATAATCTAGGGCACCTGTGGG - Intergenic
1159421998 18:68233611-68233633 TGCTCATCTACGCCACCTCTAGG + Intergenic
1160904243 19:1445104-1445126 GGTTCAGCTGAGGCACCTGCTGG + Intergenic
1161754957 19:6125892-6125914 GCCTCATCCAAGGCTCCTGTCGG - Intronic
1163402800 19:17104377-17104399 GGCACATCGAGGGCTCCTGTGGG - Intronic
1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG + Exonic
1166013352 19:39960375-39960397 GGTTGAGCTAAGGTACCTGTGGG - Intergenic
1166111898 19:40627698-40627720 GGCTCAGCCAGGGAACCTGTGGG - Exonic
1167720285 19:51175025-51175047 GCATCATCTTTGGCACCTGTGGG - Intergenic
928195748 2:29215436-29215458 GGGGCATGTAAGGCACCGGTAGG - Intronic
928258870 2:29749133-29749155 GGCACATCAAAGTCACCTGGAGG + Intronic
930187314 2:48422964-48422986 GTCTCATCTAAAGCACTTCTTGG + Intergenic
948362769 2:237434513-237434535 GGCCCATCAAAAGCACCTGGAGG + Intergenic
1180078163 21:45473623-45473645 GGCTCATCTGAGGCAGCTGATGG - Intronic
1183641051 22:39092685-39092707 GGCTCATCAATGGAACCTGCCGG + Intergenic
954202573 3:49032840-49032862 GGCTCCTCTGAAGCACCAGTGGG - Intronic
959951302 3:112183766-112183788 GGCCCATCAAAGGAACCTGGGGG - Intronic
963403620 3:144834805-144834827 GGCTCATCTTTGGCAGGTGTGGG + Intergenic
964428813 3:156582157-156582179 GGCTCATCAGAATCACCTGTTGG + Intergenic
964515994 3:157508351-157508373 GGCTCAGCATTGGCACCTGTGGG + Intronic
965255360 3:166400119-166400141 GCCTTATCTAAAACACCTGTAGG - Intergenic
973309344 4:48691063-48691085 GGGTCATCTAAATCATCTGTGGG - Intronic
985695710 5:1338962-1338984 GGCTCATCCAGGGCACTCGTCGG + Exonic
991037663 5:62144334-62144356 GGCTCCTCAAAGGCAGATGTAGG - Intergenic
1000892795 5:166818812-166818834 GGCTCAAGCAAGGCAGCTGTTGG + Intergenic
1001080586 5:168664627-168664649 GGCTCCTCTAGGGAACCTGAGGG + Intronic
1002649175 5:180679294-180679316 GGCTCTCCAAGGGCACCTGTGGG + Intergenic
1005344734 6:24877978-24878000 GACTCATCCCAGTCACCTGTTGG - Intronic
1011651715 6:89512424-89512446 GGCAAATCTAAGCCACCTCTTGG + Intronic
1014815834 6:125934524-125934546 GGCTGATCTCAGGCAACTGTGGG - Intergenic
1018185807 6:161264636-161264658 GGCTCCTCAAAGGCACTTGCAGG + Intronic
1019613402 7:1948115-1948137 GCCTCATCTGGGGCACCTGCAGG + Intronic
1019853205 7:3579872-3579894 GACTCACCCAAGGCACCTCTGGG - Intronic
1021205363 7:17773540-17773562 GGAGAATTTAAGGCACCTGTAGG - Intergenic
1022420931 7:30222795-30222817 AGCTGATCTAAAGCATCTGTAGG - Intergenic
1025637469 7:63335464-63335486 GGACCCTCTAAGGCCCCTGTAGG - Intergenic
1025645228 7:63412635-63412657 GGACCCTCTAAGGCCCCTGTAGG + Intergenic
1033366485 7:140675903-140675925 GGCTCCACTTAGGTACCTGTTGG + Intronic
1034674548 7:152883125-152883147 GGCTGATGGATGGCACCTGTTGG + Intergenic
1037741402 8:21611966-21611988 GGCACCTCTAAGGCACCGATTGG - Intergenic
1038277113 8:26130574-26130596 GTCTCATCTAAATCACATGTGGG - Intergenic
1040434879 8:47380515-47380537 GGCTCAAGAAAGGCACCTGCCGG - Intronic
1048005210 8:130413932-130413954 GGCTCCTCATAGGCAACTGTTGG - Intronic
1048859049 8:138709985-138710007 GGCTCTTCTCAGGAACCTGGGGG + Intronic
1049509282 8:143019369-143019391 GGCTGAGCTAAGGCACCGGTGGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1056752559 9:89363012-89363034 GCCTCACCTGAGGCACCTGTTGG - Intronic
1062410856 9:136423563-136423585 GGCTCCTCCAAGGAACCTGCGGG - Exonic
1194556797 X:95369514-95369536 GGCTTATCTTATTCACCTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic