ID: 903720061

View in Genome Browser
Species Human (GRCh38)
Location 1:25398445-25398467
Sequence GAGGGCTGCAGGGGTGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 2, 1: 0, 2: 7, 3: 76, 4: 584}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903720061 Original CRISPR GAGGGCTGCAGGGGTGCAGC GGG (reversed) Intronic
900231562 1:1561552-1561574 GATGGGTGCAGGGGGGCCGCGGG - Intronic
900364822 1:2306839-2306861 GTGGGCTGCAGGGGCGGAGCCGG - Exonic
900417091 1:2540266-2540288 CAGGGCTGCTGGGGTGAGGCTGG + Intergenic
900467080 1:2831102-2831124 GAGGGCTGGGGAGGTGCACCTGG - Intergenic
900483596 1:2910959-2910981 GAGGGGTGGTGGGGTGCAGTGGG + Intergenic
900985725 1:6071953-6071975 GGAGCCTGCAGGGTTGCAGCAGG - Intronic
901133674 1:6979166-6979188 GAGAGCTGGAGGGGTGGACCAGG + Intronic
901631167 1:10648890-10648912 GAGGGCTGCATGTGTGAAGGAGG + Intronic
901720010 1:11189498-11189520 GAGGTCTGCAAAGCTGCAGCAGG - Exonic
902078645 1:13806217-13806239 GCGGGATGCGGGGGAGCAGCTGG - Intronic
902338073 1:15765203-15765225 AAGAGCTGCATAGGTGCAGCCGG - Exonic
902559171 1:17266347-17266369 GAGCTCTGAAGGGGTGCAGGAGG + Intronic
902761175 1:18581623-18581645 GAGGGCTGCAGGGCTGCGGAAGG - Intergenic
902786886 1:18738614-18738636 CAGGGCAGCAGGGGTGGAGCTGG - Intronic
903262997 1:22141473-22141495 GTGGCCTGCAGGGGGGCAGTGGG + Intronic
903551694 1:24161595-24161617 GGGGCATGCAGGGGGGCAGCTGG + Exonic
903667200 1:25015411-25015433 CAGGGCTGAAGGTGGGCAGCAGG - Intergenic
903707178 1:25294897-25294919 GAGGGCTGCAGGGGTGCAGCGGG + Intronic
903720061 1:25398445-25398467 GAGGGCTGCAGGGGTGCAGCGGG - Intronic
903750030 1:25616216-25616238 CCGGGCTGCAGGGGTGCTGCTGG - Intergenic
904039918 1:27577751-27577773 GAGGGGAGCAGGGTGGCAGCTGG - Intronic
904314160 1:29649591-29649613 GAGTGCAGTAGGGGTGTAGCTGG + Intergenic
904383043 1:30124396-30124418 GAGGCCTGCAGGAGGGCTGCAGG + Intergenic
904489647 1:30850454-30850476 CAGGGCTGCAGGGGCCTAGCAGG - Intergenic
904494035 1:30876840-30876862 GGGTGCTGCAGGGGTGCTGGGGG + Exonic
904872465 1:33627431-33627453 TGAGGCTGCAGGGGGGCAGCAGG - Intronic
905249803 1:36640631-36640653 AGGGTCTGCAGGGGTGAAGCAGG + Intergenic
905734493 1:40316306-40316328 GACTGCTGCAGGGGAGCAGGAGG + Intronic
905972645 1:42153451-42153473 ATGGGCTGCAGGGCTGCATCAGG + Exonic
906458906 1:46022493-46022515 GGTTGCTGCAGGGGTTCAGCAGG - Intronic
906678297 1:47708809-47708831 GAGGGCTGGAGGGACGCGGCGGG + Intergenic
907873929 1:58467279-58467301 TAGGTCTGCAGTGGGGCAGCTGG - Intronic
908355822 1:63324004-63324026 GAGGGCAGCAGCGGCACAGCGGG - Exonic
910274437 1:85433279-85433301 GAGGGCAGCAGAGGAGCAGCAGG + Intronic
911115969 1:94247331-94247353 GCGGGCAGCAGGGGAGAAGCTGG - Intronic
912470179 1:109901357-109901379 GTGGGCTGTAGGGGTGGGGCTGG - Intergenic
912551194 1:110486510-110486532 GAGGGCTGCAGGCCTGCAGAGGG + Intergenic
914744724 1:150493312-150493334 GGGGGGTGGAGGGGTGGAGCAGG + Intronic
914847096 1:151289305-151289327 GAGGGCTGGTGGGGCGCAGGAGG + Intronic
914924414 1:151872125-151872147 GGGCACTGCAGGGGTGAAGCTGG - Intergenic
915475559 1:156150808-156150830 AAGGGTTGCAGGGGAGGAGCTGG + Intronic
915493405 1:156264556-156264578 GGAGGCTGCAGAGGTGCAGGAGG + Intronic
915515072 1:156407971-156407993 GAAGGCTGCAGGGAGGGAGCAGG + Exonic
916179255 1:162069911-162069933 GAGGGCGGCAGGGGAGGAGGTGG - Exonic
916512091 1:165481610-165481632 GAGTGCAGCTGGAGTGCAGCTGG - Intergenic
919769538 1:201148450-201148472 GAGGTGTGCAGAGGTGAAGCAGG + Intronic
919785997 1:201259177-201259199 GAGGGAGGCAGGGCTGCAGTGGG + Intergenic
920455380 1:206097235-206097257 GAGGGCTGCAGGGAGGCAGGAGG - Intronic
921005837 1:211093091-211093113 ATGGGCTGCAGGGCTGCAGCTGG - Intronic
921007904 1:211112290-211112312 GAGGGGTGGAGGGGTGGAGGGGG - Intronic
921110839 1:212035309-212035331 GAGGGCTGAATGGGTGAAACAGG - Intronic
921287541 1:213622616-213622638 GCCGACTGCAGGGGTGCCGCTGG - Intergenic
921681883 1:218043496-218043518 GTCGGCTGCAGGTGGGCAGCAGG + Intergenic
922569444 1:226625382-226625404 GAGGATTGCTGGGGCGCAGCAGG - Intergenic
922776403 1:228216040-228216062 TGGGGCTGCAGGGGTCCTGCTGG + Intronic
922985735 1:229864864-229864886 GAGGGCTCCAAGGCTGCAGGAGG + Intergenic
923888312 1:238182059-238182081 GAATGCTGCTGGAGTGCAGCGGG - Intergenic
923965648 1:239135601-239135623 GAGGGATGGAGGAGTGAAGCAGG - Intergenic
924927932 1:248701755-248701777 GAGGGGTGCAGGGGAGCAAGGGG - Intergenic
924934216 1:248754850-248754872 CAGGCCTGGAGGGGTGCACCCGG - Intronic
1062854683 10:773991-774013 GGCTGCTGCAGGGGTGCAGGAGG + Intergenic
1064024208 10:11833934-11833956 GAGGGCAGCAGGGAGGCAGTGGG + Intronic
1064847028 10:19667082-19667104 GGGGCCTTCTGGGGTGCAGCTGG - Intronic
1066185412 10:33005728-33005750 GGGGGCTGCAGGGACCCAGCCGG + Intronic
1066254115 10:33662121-33662143 GAGGCGTGGAGGGGTGCAGTGGG - Intergenic
1067799806 10:49351198-49351220 GAGGGCTGCAGGGGCAAGGCAGG - Intergenic
1069590004 10:69635701-69635723 GAGGGCACCAGGAGGGCAGCTGG - Intergenic
1069697449 10:70397303-70397325 TAGGGCTGGAGAGGAGCAGCAGG - Intergenic
1069914825 10:71780995-71781017 GACGGATGGAGGGCTGCAGCAGG + Intronic
1070323315 10:75371276-75371298 GAAGGCTGCAGGGCTTCAGGAGG + Intergenic
1071204615 10:83259777-83259799 GAGGGAGGCAGGGGTGCTACTGG - Intergenic
1071296217 10:84222031-84222053 CGGGGCTGCAGGGGTGCAGCTGG + Exonic
1072548285 10:96457293-96457315 GAGGGAGGCTGGGGTGCAGCAGG - Intronic
1075078085 10:119364575-119364597 GTGGGCAGCTGGGGTACAGCAGG - Intronic
1075708438 10:124517241-124517263 GAGCGCTGCAGGTGCGCACCGGG + Exonic
1075734518 10:124655626-124655648 GACTGCAGCAGGGGTTCAGCAGG + Intronic
1075782443 10:125026195-125026217 GATGGCCCCAGGGGTGCACCTGG + Exonic
1076035509 10:127196161-127196183 GCGGGCAGCAGGCGCGCAGCGGG - Intronic
1076581860 10:131517229-131517251 GAGGGAGGCTGGGGAGCAGCTGG - Intergenic
1076594428 10:131617228-131617250 GAGGACGGCAGTGGTGCAGGTGG - Intergenic
1076763810 10:132619636-132619658 GAGGGCTGCACCCCTGCAGCAGG + Intronic
1076811394 10:132888384-132888406 GCAGGCGGCAGGGGTGCAGGCGG - Intronic
1076811399 10:132888399-132888421 GAAGGCGGCAGGGGTGCAGGCGG - Intronic
1076811448 10:132888558-132888580 GCAGGCGGCAGGGGTGCAGGCGG - Intronic
1076811453 10:132888573-132888595 GCAGGCGGCAGGGGTGCAGGCGG - Intronic
1076811458 10:132888588-132888610 GAAGGTGGCAGGGGTGCAGGCGG - Intronic
1076811463 10:132888603-132888625 GAAGGCGGCAGGGGTGAAGGTGG - Intronic
1076811473 10:132888633-132888655 GCAGGCGGCAGGGGTGCAGGCGG - Intronic
1076811494 10:132888704-132888726 GCAGGCGGCAGGGGTGCAGGCGG - Intronic
1076824853 10:132961707-132961729 CAGGGGAGCAGGTGTGCAGCAGG - Intergenic
1076855958 10:133115742-133115764 GAGGGTTGGAGGCTTGCAGCCGG - Intronic
1076879003 10:133230899-133230921 GAGGGCTGCGGGGGAGGGGCGGG + Intronic
1076930796 10:133530461-133530483 GGGTGGGGCAGGGGTGCAGCTGG - Intronic
1077117753 11:893019-893041 GGAGGCTGCAGAGGTGCAGAGGG + Intronic
1077189905 11:1251585-1251607 GAGCACTGCAGGGGTGCGGGTGG - Exonic
1077225764 11:1438498-1438520 CAGGGCTGCTGGGATGCAGCAGG - Intronic
1077273861 11:1694231-1694253 CAAGGCTGCAGGGATGCGGCTGG - Intergenic
1077327726 11:1970945-1970967 GAGGGTGGCAGGGGTGGGGCAGG + Intronic
1077562634 11:3273544-3273566 GAGGCTGGCAGGAGTGCAGCAGG - Intergenic
1077568527 11:3319363-3319385 GAGGCTGGCAGGAGTGCAGCAGG - Intergenic
1077714712 11:4569410-4569432 GAGGGCAGCAGGAGGGCGGCAGG + Intergenic
1078663274 11:13304200-13304222 GGGGGATGCAGGGGAGAAGCGGG + Intronic
1079114641 11:17633662-17633684 GAAGGCTGCAGGGGCACAGTGGG - Exonic
1079238851 11:18708210-18708232 GAAGGCTGCATGGATGCAGAGGG + Exonic
1080824048 11:35832970-35832992 GAGGGCTGCTGAGGGGAAGCTGG + Intergenic
1080997250 11:37619079-37619101 GGGGCCTGCAGGTGTGCAGAAGG + Intergenic
1081723068 11:45304197-45304219 GAGGGAGGCAGAGGTGCAGTTGG + Intergenic
1081731777 11:45376784-45376806 GACGGCTGCAGGGCTGGACCAGG - Intergenic
1082010761 11:47448426-47448448 GTGGGCTCCAGGGTTGCGGCTGG - Intronic
1083401215 11:62424755-62424777 GAGGACTGCAGAGGGGCTGCAGG + Intergenic
1083609288 11:63997559-63997581 GGGGGCAGCAGGGCAGCAGCGGG - Exonic
1083702779 11:64490697-64490719 GACGGCTGCAGGTGTGGAACAGG - Intergenic
1083895687 11:65618728-65618750 GAGAGCTCCCGGGGTGCAGCAGG + Exonic
1084019673 11:66410055-66410077 GTGGCCTGCAGGGGTCCGGCAGG + Intergenic
1084052986 11:66613106-66613128 GAGGGCTGCAGGAGCGAAGAGGG + Intergenic
1084262825 11:67990397-67990419 CGGGCCTGCTGGGGTGCAGCTGG + Intergenic
1084453448 11:69253514-69253536 GAAGGCAGCAGGGGTCCAGGAGG + Intergenic
1084779226 11:71397678-71397700 GGGGGCTGCTGGGCTGCCGCTGG - Intergenic
1084810568 11:71608708-71608730 CGGGCCTGCTGGGGTGCAGCTGG - Intergenic
1085040054 11:73321811-73321833 GGGGTCTGGAGAGGTGCAGCAGG + Intronic
1086889208 11:92237009-92237031 GAGGCCTGCTGGGTAGCAGCAGG + Intergenic
1086908579 11:92445743-92445765 GGGGGGTGCAGGGGAGCAGGTGG + Intronic
1087144354 11:94797594-94797616 CAGGCCTGCAGGGCTGTAGCAGG + Intronic
1087175509 11:95091516-95091538 GTGAGCTCTAGGGGTGCAGCTGG - Intronic
1088432142 11:109770194-109770216 GAGAGCTGCAGAGGCTCAGCTGG - Intergenic
1089257346 11:117200849-117200871 GAGCCCAGCAGGGGTGCAGAAGG + Intronic
1089498368 11:118919090-118919112 GGGGGGGGCAGCGGTGCAGCTGG - Intronic
1089682573 11:120127464-120127486 GAGGGCTGCGCTGGAGCAGCGGG - Exonic
1089713515 11:120335739-120335761 CAGGGCTGCGGGAGAGCAGCTGG - Intergenic
1090406561 11:126479266-126479288 GCTGACTGCAGGGCTGCAGCGGG - Intronic
1091232700 11:133998973-133998995 GAGGGCTGCTGTTGTGCAGGAGG - Intergenic
1202810708 11_KI270721v1_random:26125-26147 GAGGGTGGCAGGGGTGGGGCAGG + Intergenic
1091388312 12:109303-109325 GAGGGCTGCAGGGCTGGATGGGG - Intronic
1091970759 12:4785004-4785026 GGGGTCTGGAGGGGTGCAGCAGG - Intronic
1092171112 12:6374659-6374681 GTGGGCTGCTGGGGCGCCGCAGG + Exonic
1095205390 12:39434147-39434169 GAGGCCTGCAGGCCTGCATCTGG + Intronic
1095867005 12:46983365-46983387 GAAGGCTGGAGGGGTTCAGGTGG - Intergenic
1096355568 12:50938182-50938204 GGGGGGTGGAGGGGTGCAGAGGG - Intergenic
1096461131 12:51821842-51821864 GGGGGCTGCAGGAGCGCGGCCGG + Intergenic
1096572562 12:52532124-52532146 GAGGGCTGAAGGGGCACCGCTGG - Intergenic
1097160956 12:57046446-57046468 GAGGGCTGTAGGGGCCCAGAGGG + Intronic
1098472541 12:70862204-70862226 CAGGGCTGCAGAGCTGAAGCTGG - Intronic
1101259444 12:103013543-103013565 TAGGTGTGCAGGGGTGCAGCAGG + Intergenic
1103834408 12:123807621-123807643 GAGGGTGGCAGGGGTGGATCAGG + Intronic
1104402049 12:128484370-128484392 GAGGGTAGCAGGTGTCCAGCAGG + Intronic
1104682392 12:130760824-130760846 CTGGCCTGCAGGGGTGGAGCAGG - Intergenic
1104828770 12:131733806-131733828 GAGGGCTGCTGCGCTGCGGCAGG - Intronic
1104854902 12:131896926-131896948 GAGCCCTGGAGGGGAGCAGCAGG - Intronic
1104970293 12:132527866-132527888 GAGGGCTGCAGGGCAGCTGTCGG + Intronic
1104971807 12:132534159-132534181 GAGGTCAGCATGGGGGCAGCAGG + Intronic
1105072426 12:133242847-133242869 GGGTGCTGCAGGGCTGCTGCTGG - Intergenic
1105429190 13:20321737-20321759 GAGGGCTCCAGGGGCTCAGAAGG + Intergenic
1107609602 13:42099863-42099885 GGGGGCTGCAGAGGTGCTTCTGG + Intronic
1108186379 13:47892387-47892409 GAGCGCTGTGGGGGTGCAGGGGG + Intergenic
1110411155 13:75204926-75204948 GAGGGCTCCACTGTTGCAGCAGG + Intergenic
1112249116 13:97762621-97762643 CAAGGCTGCAGGGGGGCGGCAGG + Intergenic
1112388925 13:98964965-98964987 GAGGGCTGTATGGGTGAAGGTGG - Intronic
1113169305 13:107481708-107481730 GAGGGCTTCAAGGGTGAAGTGGG + Intronic
1113677032 13:112214642-112214664 GAGGGCTGGAGGGGAGGAGGGGG + Intergenic
1113852629 13:113426478-113426500 CAGAGCTGGAGGGCTGCAGCGGG + Intronic
1113955985 13:114099922-114099944 GGGGGCTGCAGGGGGGCTGTGGG - Intronic
1115429163 14:33296546-33296568 GAGGGCACCTGGGGTGCAGCTGG + Intronic
1116966093 14:51016468-51016490 GAGAGCTGCAGGGGGGTAGGGGG - Intronic
1117547512 14:56805327-56805349 GAGGGGTGCGGGAGTGCAGCAGG + Intronic
1118850138 14:69576719-69576741 AAGGGCTGCAGAGGTCCAGGAGG + Intergenic
1119400605 14:74359813-74359835 GAGGACTGCAGGGTCCCAGCAGG - Exonic
1120941735 14:89956064-89956086 GCGGGCTGCTGGGGTCCGGCAGG + Intronic
1121104340 14:91270963-91270985 GAGGGGTGGAGGGGCGCAGAGGG + Intergenic
1121104354 14:91270999-91271021 GAGGGGTGGAGGGGCGCAGAGGG + Intergenic
1121104425 14:91271174-91271196 GAGGGGTGGAGGGGCGCAGAGGG + Intergenic
1121312591 14:92943315-92943337 ACGGGCTGCAGGGGTGCGGTGGG - Intronic
1121931713 14:97978219-97978241 GAGAGTTGCAGGGAAGCAGCAGG + Intergenic
1122421621 14:101581510-101581532 GGGGGCTGCAGGGATGTAGCAGG - Intergenic
1122542443 14:102505838-102505860 GAGGGCTGAAGGTCTGCAGGAGG - Exonic
1122987271 14:105218296-105218318 GGGGGCAGCAGGGGTGGTGCAGG - Intronic
1123435287 15:20249734-20249756 GAGGGGTGCAGGCCTGCAGAGGG - Intergenic
1124347484 15:28932263-28932285 GTGGACTGCAGGGGTGCTCCAGG - Intronic
1124366166 15:29072861-29072883 AGGTGGTGCAGGGGTGCAGCTGG - Intronic
1124617076 15:31249483-31249505 GAGGCCTGCAGGGGTGTGGTGGG - Intergenic
1124653445 15:31489046-31489068 GAGGGCTGCAGGGCTGGCTCAGG + Intronic
1124687158 15:31792410-31792432 GAGGGCGGCAGGACTGGAGCAGG - Intronic
1124931754 15:34126757-34126779 GAGGGCTGCCTGACTGCAGCAGG + Intergenic
1125757284 15:42072208-42072230 GGGGGCTGTCGGGGTGCAGAGGG + Intronic
1125875202 15:43138039-43138061 GGGGCCTTCAGGGCTGCAGCAGG - Intronic
1126583914 15:50264781-50264803 GAGGGTTGAAGGGGAGCAGAAGG - Intronic
1128260015 15:66226869-66226891 GCGGGCTGCAGGGCTGCCTCTGG - Intronic
1128505813 15:68271957-68271979 CTGGGCTGCAGGGGCGGAGCAGG - Intergenic
1128570286 15:68728676-68728698 AAGGGCTGCAGAGGAACAGCGGG + Intergenic
1128716767 15:69914297-69914319 GAGGGCTGCAGGGCAGGAGCAGG - Intergenic
1129606097 15:77025701-77025723 GAGGGCGGCAGGGGTGGTGGTGG + Intronic
1129672258 15:77613884-77613906 GAGGGCTGGCGGGGGGCAGCAGG + Exonic
1132024499 15:98393241-98393263 AAGGGCTGCAGTGGTGAAGATGG - Intergenic
1132170731 15:99651463-99651485 CAGGGCTGCAGTGGAGCATCAGG + Intronic
1132318623 15:100908957-100908979 GAGGGCCGCAGAGGCCCAGCAGG - Intronic
1132516128 16:366857-366879 GGGGCATCCAGGGGTGCAGCCGG - Intergenic
1132557012 16:576978-577000 GTGGGCTGCAGGTGTGCACTGGG + Intronic
1132675524 16:1119784-1119806 GGGGGCAGCAGGGGGGCATCGGG - Intergenic
1132878304 16:2149859-2149881 GGGGGCTGCAGGTGAGGAGCAGG - Intronic
1133029835 16:3005065-3005087 GAGGCCTGCTGGAGGGCAGCAGG - Intergenic
1133240552 16:4411932-4411954 TTGGGCTGCAGGGGTGGAGATGG - Intronic
1134040879 16:11067406-11067428 GAGGGCTGCAGGGGGGGTGTGGG + Intronic
1134195652 16:12157097-12157119 GATGGCTGCAGGTGGGCAGCCGG + Intronic
1135046902 16:19163361-19163383 GAGAGATGCAGGTGTGCTGCAGG - Intronic
1136272194 16:29154928-29154950 AGGGGCCGCAGGGGGGCAGCTGG + Intergenic
1136499445 16:30662732-30662754 GTGGCCGGCAGGGGTGCAGGGGG - Exonic
1136511039 16:30738492-30738514 AAGGGCTGCTGGGGTGGAGTGGG - Exonic
1137596191 16:49725643-49725665 GGGGGCTGCAGAGGGCCAGCAGG + Intronic
1137694234 16:50450517-50450539 GATGGCTGGAGGGGAGCAGCAGG - Intergenic
1137721522 16:50630336-50630358 GAGGGCTGCAGGGCTGAGCCTGG + Intronic
1138340267 16:56284624-56284646 GTGTGCTGCTGGGGGGCAGCTGG - Intronic
1138598738 16:58042862-58042884 GAGGGCTGCAGGTGTGCTCCAGG + Intronic
1139613977 16:68078036-68078058 AAGGGCTGCAGGGATGAAACTGG - Intronic
1139653597 16:68374729-68374751 GAGGGCTGCAGGTTTGCTGGGGG - Intronic
1140476998 16:75244036-75244058 GAGGGCTGCATGGGTTCCACAGG + Intronic
1141072884 16:80974053-80974075 GAGGGCTTCCGGGTTGCTGCTGG - Exonic
1141440348 16:84025925-84025947 AAGTGCTGCGGGGGTGCAGGAGG - Intronic
1141638639 16:85328877-85328899 AGGGGTGGCAGGGGTGCAGCTGG - Intergenic
1141961452 16:87411974-87411996 GCGGGCTGCGGGGGTGCCGGGGG + Exonic
1142029120 16:87829695-87829717 GGGAGCTGCAGGGGTGAAGTTGG - Intergenic
1142075771 16:88116832-88116854 AGGGGCCGCAGGGGGGCAGCTGG + Intronic
1142236158 16:88923573-88923595 GGGGGCAGCTGGGGAGCAGCTGG + Intronic
1142252245 16:88997339-88997361 GATGGGTGAAGGGGTGCAGGAGG - Intergenic
1142351729 16:89583779-89583801 GCAGGCTGCAGGGGTGCGCCCGG - Intronic
1142356645 16:89604564-89604586 GAGGGCTGGAGGGGAGCACTGGG + Intergenic
1142356652 16:89604584-89604606 GGGGGCTGCAGGGGAGCAGTGGG + Intergenic
1142359336 16:89619221-89619243 GGGGGCTGCAGGGAGGGAGCAGG - Intronic
1142359427 16:89619421-89619443 GAGGGGAGCAGGGGGGCAGGGGG - Intronic
1142359441 16:89619451-89619473 GAGGGGAGCAGGGGGGCAGGGGG - Intronic
1142359455 16:89619481-89619503 GAGGGGAGCAGGGGGGCAGGGGG - Intronic
1142365989 16:89649983-89650005 GAGTGCTGGAGGGGTGCGGGGGG - Intronic
1142745711 17:1956676-1956698 GAGGGCTGCAGGGGAGCTCAGGG + Intronic
1142851068 17:2704989-2705011 CTGGGCTGCAGGGGGGCTGCAGG + Intronic
1143023352 17:3927868-3927890 GAGGCCTGCACTGGGGCAGCTGG - Intronic
1143119170 17:4596613-4596635 GAGGGCTGTAGGGGTGTGGACGG + Intronic
1143145088 17:4770064-4770086 AAGGGCTGCAGGGCTTCAGAGGG - Intergenic
1143271415 17:5678289-5678311 AAAGCCTGCAGGGGTCCAGCAGG - Intergenic
1143493414 17:7296635-7296657 AAGGGCCGGAGGGGTGCGGCGGG - Intergenic
1143658747 17:8312235-8312257 GGGGGCTTGAGGGATGCAGCTGG - Exonic
1143660019 17:8318945-8318967 GTGGGCAGGAGGGGTCCAGCGGG + Intronic
1143683637 17:8496204-8496226 GAGGGACGCAGAGGGGCAGCAGG + Intronic
1144454987 17:15411596-15411618 TAGGGCAGAAGAGGTGCAGCTGG + Intergenic
1144647016 17:16981989-16982011 CAGGGGTGCGGGGATGCAGCAGG + Intergenic
1144715910 17:17435817-17435839 GAGGGATGAAGGGGTCCATCTGG + Intergenic
1145749525 17:27345208-27345230 GAAGGCTGAGGGGGTGCAGGTGG - Intergenic
1145876315 17:28320747-28320769 GAGGGCTCCAGGGGAGAATCTGG + Intronic
1146126789 17:30237126-30237148 GAATGCTGGAGGGGTGCAGGGGG + Intergenic
1146126791 17:30237134-30237156 GAGGGGTGCAGGGGGGATGCCGG + Intergenic
1146126842 17:30237265-30237287 AAGGGCTGCAGGGGGGATGCTGG + Intergenic
1146126860 17:30237308-30237330 GGGGGCTGCAGGGGGGATGCTGG + Intergenic
1146918051 17:36690697-36690719 GAAGGCTGCAGAGGAGCAGGAGG + Intergenic
1147215827 17:38898537-38898559 GAGGGCAGCAGGGATGCCGCAGG - Intronic
1147247640 17:39132680-39132702 GAGGGCTGAATGGAGGCAGCTGG + Intronic
1147586084 17:41654693-41654715 CAGGGCTGCAGTGGTGGAGGAGG + Intergenic
1148072648 17:44917018-44917040 GAGGGGGGCTGGGGTGCGGCGGG + Intergenic
1148122764 17:45222289-45222311 GGGGGCGGCAGGGGCGCGGCAGG + Intronic
1148474346 17:47917065-47917087 GAGGGCTTCTGGGGTACAGTGGG - Exonic
1149739512 17:59031898-59031920 GTGGGCTGCAGAAGTGAAGCAGG + Exonic
1150122690 17:62617154-62617176 GAGGGGTCCAGGGCTGCAGAAGG + Intergenic
1150579335 17:66457917-66457939 GAGGTCTGCAGGAGTACAGCAGG - Intronic
1151122590 17:71808906-71808928 AAGTGCTGCAGTGGGGCAGCAGG - Intergenic
1151185403 17:72360522-72360544 GAAGCCTGCATGGGTGCAGTAGG - Intergenic
1151185846 17:72363461-72363483 CAGGTCTCCAGGGCTGCAGCCGG - Intergenic
1151227166 17:72655978-72656000 CAGGGCTGCAGGAGGGGAGCTGG - Intronic
1151356239 17:73560269-73560291 CTGGGCTGCAGGGCTGGAGCTGG + Intronic
1151396263 17:73825112-73825134 GAGGGCTGCAGGGGTGTGAGTGG + Intergenic
1151548090 17:74805679-74805701 GAGGGCTGCACAGGCCCAGCTGG - Intronic
1151764335 17:76124430-76124452 CCAGGCTGCAGGGGTGAAGCAGG + Intergenic
1151960046 17:77400956-77400978 GATGGCTGCAGGGCGGGAGCTGG + Intronic
1152045182 17:77930684-77930706 GGGAGCTGCAGGGGGGAAGCTGG - Intergenic
1152210433 17:79000415-79000437 GAGGGGTGGAGGGAGGCAGCCGG - Intronic
1152586216 17:81190607-81190629 GGGGGCTGCAGGGCTGGAGACGG - Intronic
1152714821 17:81893917-81893939 CAGGGCTGCAGGGGAGCTACGGG - Intronic
1152758405 17:82096715-82096737 CAGGGCTGCAGGGCTCCAGTGGG - Intronic
1152794175 17:82298757-82298779 CAGGGCTCCAGGGGGGCGGCAGG + Intergenic
1152855526 17:82663153-82663175 GAGGCCTGAAGCTGTGCAGCAGG + Intronic
1152885538 17:82846922-82846944 GAGGACCCCGGGGGTGCAGCTGG - Intronic
1153834135 18:8949257-8949279 GAAGGCAGCAGGGGTGGGGCAGG + Intergenic
1153834520 18:8951949-8951971 GGGCGGTGCAGGGGTGCAGCAGG - Intergenic
1156233997 18:35183401-35183423 GAGGGCTGCATTGCTGCTGCAGG + Intergenic
1157283808 18:46363540-46363562 GAGGTTTGCAGGGGTGAATCAGG - Intronic
1157576740 18:48748738-48748760 GAGGGCTGCTGAGGTCCAGGAGG + Intronic
1157926970 18:51777047-51777069 GTGGACTGGAGGGGTGCAGGAGG + Intergenic
1158139680 18:54242613-54242635 GTGGGCTCCTGGGATGCAGCGGG + Intergenic
1158522519 18:58183548-58183570 GGGTGCTGCAGGTGAGCAGCTGG - Intronic
1158692434 18:59672615-59672637 GCAGGCTGCAGTGGTTCAGCTGG - Intronic
1158841998 18:61397396-61397418 CAGGGCTGCGGGGCTGCAGCAGG - Intronic
1160051844 18:75440977-75440999 GAGGGATGGAGGGTTGCAGCGGG + Intergenic
1160225149 18:77006419-77006441 GAGGGCGCCAGTGGTGCAGCTGG - Intronic
1160456512 18:79006060-79006082 GAGGGCTGCACGTGGGCTGCAGG - Intergenic
1160511286 18:79454882-79454904 GAGGGGTGCAGGTGTGAAGGTGG - Intronic
1160585494 18:79911398-79911420 GAGGGCTCCAGAGTTCCAGCCGG + Intronic
1160778241 19:866543-866565 GAGGGGTGCAGGCCTGCGGCGGG - Intergenic
1160786907 19:904470-904492 GGGGGTTGCAGGGGTGGAGTGGG - Intronic
1161014371 19:1976338-1976360 CAGGGCTGCAGGGAGGCACCTGG + Intronic
1161082669 19:2319276-2319298 GAGGGGTGCAGCGGTGAGGCAGG + Intronic
1161089635 19:2353399-2353421 GGGAGCAGCAGGCGTGCAGCCGG - Exonic
1161354488 19:3811247-3811269 CAGGGGGGCAGGGGTGGAGCAGG - Intronic
1161360281 19:3844941-3844963 GGGGGCTGCAGGGTTGCCCCAGG + Intronic
1161365681 19:3878028-3878050 GAGCCCTGCCTGGGTGCAGCGGG - Intergenic
1161366163 19:3880941-3880963 GAGCCCTGCCCGGGTGCAGCTGG - Exonic
1162069675 19:8146221-8146243 GATGGCTGGATGAGTGCAGCGGG + Exonic
1162128813 19:8513146-8513168 AGGGGCTGGAGGGATGCAGCAGG - Exonic
1162935814 19:13980946-13980968 GAGAGCTTCAGGGGTGCTGGCGG - Intronic
1163015344 19:14451123-14451145 CAGGGCTGCAGGGGTGGGGTAGG - Intronic
1163311047 19:16514770-16514792 CAGGGCTGCAGGGATGCAGTGGG + Intronic
1164189545 19:22901740-22901762 GAAGGGTGCAGGGGTGGAACAGG - Intergenic
1166289154 19:41850675-41850697 GTGGGCCACAGGGGTGAAGCAGG - Exonic
1166353049 19:42209741-42209763 GACTGCTGCTGGGGTGCGGCTGG + Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166864070 19:45825680-45825702 GAGGGCAGCAGAGCAGCAGCGGG - Intronic
1166870178 19:45865919-45865941 GAGTTCTGCAGAGGTCCAGCTGG - Intronic
1167349507 19:48965645-48965667 GAGGGCCGGAGGTGCGCAGCTGG - Intronic
1167571359 19:50290889-50290911 GAGAGATGCAGAGGTGGAGCGGG + Exonic
1167605392 19:50479136-50479158 GAAGGCTGCTGGGGACCAGCAGG - Intronic
1168288001 19:55343888-55343910 CAGGGCTGGAGGGGTGTAGTGGG + Intronic
925429536 2:3779209-3779231 GAAGGCAGCAGGTGTGCAGGTGG + Intronic
925871812 2:8278239-8278261 GAGGGCAGCTGGGGTGCGGGAGG - Intergenic
926296738 2:11574433-11574455 GAGGGCTGGAGGTGTACAGGTGG + Intronic
926355696 2:12038898-12038920 GAAGGCTGCAGGGGTGAGTCAGG + Intergenic
927686859 2:25177285-25177307 GCGTGTTGCAGGGGTGAAGCGGG - Intergenic
928944561 2:36760945-36760967 GAGAGGGGGAGGGGTGCAGCTGG - Intronic
929751095 2:44714573-44714595 GAGGGGTGGAGAGGAGCAGCAGG - Intronic
929794774 2:45050571-45050593 GAGGGATGCAGGGTAGCAGTAGG - Intergenic
930156434 2:48111777-48111799 CAGGGCTCCAGGGGTGGGGCTGG - Intergenic
931462043 2:62457633-62457655 GTGGGCTGCCTGGGTGCAGAGGG + Intergenic
933632428 2:84673071-84673093 GAGGGATTCAGGGGTGGGGCTGG + Intronic
933832447 2:86221927-86221949 GTTGGCTGCTGGGGTGGAGCTGG - Intronic
934975570 2:98799801-98799823 CAGAGCTGCAGGGGTGAAGCAGG - Intronic
935154613 2:100472303-100472325 GAAGGCTGCTGGCATGCAGCTGG - Intronic
935400200 2:102652367-102652389 TTGGGCTGCAGGGGAGCAGAGGG - Intronic
935815505 2:106843098-106843120 GCAGGCCGCGGGGGTGCAGCTGG + Exonic
936047219 2:109197154-109197176 CTGGGCCGCAGGGCTGCAGCAGG - Intronic
936261818 2:110966339-110966361 GGGGCCAGCAGGGGTCCAGCAGG + Intronic
937044359 2:118843396-118843418 GAGGGAGCCAGGGGTTCAGCAGG - Intronic
937293583 2:120796596-120796618 GAGGGTTGCAGGGGCACAGCGGG - Intronic
937439709 2:121905518-121905540 GAGGTTGGCAGGGGGGCAGCAGG + Intergenic
937886250 2:126901692-126901714 CAGGGCAGCAGGGGTGAAGGTGG - Intronic
937958225 2:127435415-127435437 GAGGGCTGCAAGGGTGAAGCTGG - Intergenic
938246087 2:129779105-129779127 GACGCGTGCAGGGGTGCTGCTGG + Intergenic
938367291 2:130744924-130744946 TAGGGCGGCCGGGGAGCAGCAGG + Intergenic
938406980 2:131038260-131038282 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938406995 2:131038322-131038344 GGGGGCTGCAAGGCTGCAGGAGG - Intronic
938407013 2:131038382-131038404 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407034 2:131038473-131038495 GAGGGCTGCAAGGCTGCAGGAGG - Intronic
938407052 2:131038535-131038557 GGGGGCTGCAAGGCTGCAGGAGG - Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938689690 2:133776197-133776219 GAGGGCAGCAGGGGTGGGACAGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941155386 2:161971694-161971716 CAGTGCTGCCGGGATGCAGCCGG + Intronic
942452629 2:176117733-176117755 CAGGGCAGCAGGGGAGAAGCGGG - Intronic
943650979 2:190457248-190457270 GAGGGCCACAGGGGTGGACCGGG - Intronic
945940278 2:215942388-215942410 GAGGGGCGCAGGGGTGCCTCAGG - Intergenic
947385530 2:229586861-229586883 CAGGGCTCCTGGCGTGCAGCAGG + Intronic
947824150 2:233092871-233092893 GATGGCTGTAGGGGTGCTGGGGG - Intronic
948043963 2:234928531-234928553 GAGAGCTGGAGAGGAGCAGCTGG + Intergenic
948673765 2:239585061-239585083 CAGGGCAGCAGGGGGGCAGCAGG - Exonic
948674936 2:239591678-239591700 GAGGGAGGCCGGGGTCCAGCAGG + Intergenic
949016164 2:241712297-241712319 TAGGGCTGCTGTGGTGCGGCTGG + Intronic
949020691 2:241739574-241739596 GGGGGCTGCAGAGAGGCAGCAGG - Intronic
1169365269 20:4987059-4987081 GGGGACTGCAGGGCTGCAGGTGG + Intronic
1170584355 20:17723159-17723181 ATGGGCTGCAGGGGTGGGGCTGG - Intronic
1171391066 20:24802093-24802115 GTGGGGTGTAGGGGTACAGCAGG - Intergenic
1171456972 20:25277631-25277653 GAGGGCTGACGGGCTCCAGCTGG - Intronic
1171869905 20:30516393-30516415 GAGGGTTGCAAGGGTGCTGCTGG - Intergenic
1172007618 20:31828275-31828297 AAGGGCAGCAGGAGTGCAGGGGG + Intronic
1172448331 20:35004576-35004598 GAGGGAGGCAGGGGTGCAGCAGG + Intronic
1172602022 20:36190591-36190613 GAGGGATGCAGGGGAGGAGGAGG - Intronic
1172760122 20:37315735-37315757 GAGGGGTGCAGAGGGCCAGCCGG - Intronic
1172978757 20:38925816-38925838 TAGGGCTGCCGGGGTGCAGGTGG + Intergenic
1172983541 20:38963281-38963303 CAGACCTGCAGGGGTGCAGGTGG - Intronic
1173001664 20:39109785-39109807 GGGGGCTGCCGGGGTGGAACCGG - Intergenic
1173503348 20:43568943-43568965 GAGGGAGGCAGCGGTGCAGCTGG + Intronic
1173578908 20:44132655-44132677 GAGAGCTGCAGGTGTGGAGGGGG - Intronic
1173578921 20:44132693-44132715 GAGAGCTGCAGGTGTGGAGGGGG - Intronic
1173578934 20:44132731-44132753 GAGAGCTGCAGGTGTGGAGGGGG - Intronic
1173578947 20:44132769-44132791 GAGAGCTGCAGGTGTGGAGGGGG - Intronic
1173578985 20:44132878-44132900 GAGAGCTGCAGGTGTGGAGGGGG - Intronic
1173983973 20:47246836-47246858 GAGGGCTGGAAGGGAACAGCAGG + Intronic
1174166385 20:48586496-48586518 GAAGCCTGCAGGGGTGGAGCAGG - Intergenic
1174180075 20:48669036-48669058 GAGGGCTGCAGGGAGGTGGCAGG - Intronic
1174873365 20:54204071-54204093 GGGAGCTGCTGGGGTGGAGCAGG - Intergenic
1175101773 20:56584499-56584521 GAGGGCAACTGGGGTGCAGATGG - Intergenic
1175377747 20:58541060-58541082 GAGGGCTGCAGAGGAGAAGGTGG - Intergenic
1175812377 20:61865141-61865163 GAGGGATGCAGGGTGGCAGGAGG - Intronic
1175838652 20:62012828-62012850 GAGCGCTGCAGGGTTGCACTGGG + Exonic
1175949851 20:62577614-62577636 GAGGGCAGCAGGGCTGGGGCTGG + Intergenic
1176021588 20:62965036-62965058 AATGGCTGCAGAGGGGCAGCAGG - Intronic
1176026121 20:62986468-62986490 TAGGGGTGCAGGTGTGCAGGGGG + Intergenic
1176140656 20:63543316-63543338 GGGGCATGCAGGGCTGCAGCAGG + Exonic
1176208846 20:63906997-63907019 GAGGGTTGCAGGAGTCCAGGAGG + Intronic
1176284446 21:5012152-5012174 GGGGGCTGCATGGGGTCAGCGGG - Intergenic
1178095799 21:29213542-29213564 GAGGGTTGCAGGGGCAAAGCAGG - Intronic
1178898807 21:36582932-36582954 GAGGGCTGCAAGTGTCCAGGAGG + Intergenic
1179437158 21:41369815-41369837 GCGGGGGGCAGGGGTGCGGCGGG - Intronic
1179616134 21:42584459-42584481 GTGGGATGCAGGGGCACAGCAGG + Intergenic
1179872735 21:44251323-44251345 GGGGGCTGCATGGGGTCAGCGGG + Intronic
1179893765 21:44350475-44350497 GTGGGGTGCAGGGGCGCAGGCGG + Intronic
1179970779 21:44836015-44836037 GGGGGCTGCAGGGGTGGGGTGGG - Intergenic
1179970792 21:44836040-44836062 GGGGGCTGCAGGGGTGGGGTGGG - Intergenic
1179970864 21:44836188-44836210 GGGGGCTGCAGGGGTGGGGTGGG - Intergenic
1179970889 21:44836234-44836256 GGGGGCTGCAGGGGTGGGGTGGG - Intergenic
1179970925 21:44836310-44836332 GGGGGCTGCAGGGGTGGGGTAGG - Intergenic
1179970937 21:44836335-44836357 GGGGGCTGCAGGGGTGGGGTGGG - Intergenic
1179970956 21:44836372-44836394 GGGGGCTGCAGGGGTGGGGTGGG - Intergenic
1179970978 21:44836413-44836435 GGGGGCTGCAGGGGTGGGGTGGG - Intergenic
1180075112 21:45458114-45458136 GAGGGAGGGAGGGCTGCAGCGGG + Intronic
1180075860 21:45461510-45461532 GAGCCCTGCAGGGGGGCACCAGG - Intronic
1180109041 21:45639257-45639279 GAGGGCGCCAGGGTGGCAGCAGG + Intergenic
1180202639 21:46234728-46234750 GAGGAGTGCAGGGGTGTAGCTGG - Intergenic
1180979836 22:19873295-19873317 GAGGGCCACAGCGGGGCAGCAGG - Intergenic
1181051082 22:20238611-20238633 CAGGGCCGCAGGGGTGGAGTCGG + Intergenic
1181528437 22:23502749-23502771 GAGGGGTGGAGGGGTGAAGGAGG - Intergenic
1181696246 22:24594186-24594208 TGGGGCTGCAGGGGCCCAGCAGG - Intronic
1182058454 22:27379556-27379578 GTGGGCTGGAGAGGTGCAGTAGG + Intergenic
1182252366 22:29011285-29011307 GCTGGCTGCGGGGGTCCAGCAGG + Intronic
1183212266 22:36458257-36458279 GAGAGCTGCAGCCCTGCAGCCGG + Intergenic
1183481984 22:38070224-38070246 GAGGGCTGCAGGGGAGAGGTGGG - Intronic
1183512620 22:38244944-38244966 CAGGGCAGCAGGGGTGAGGCTGG + Intronic
1183603115 22:38851394-38851416 CTGGGCTGCAGGGGGGCAGCAGG + Intergenic
1183622994 22:38985743-38985765 GAGGAGTGCAGGGGTGGGGCAGG - Intronic
1183632999 22:39044872-39044894 GAGGAGTGCAGGGGTGGGGCAGG - Intronic
1184210979 22:43035439-43035461 AGGGGCTGCAGGGCTGCTGCGGG + Intergenic
1184400432 22:44270731-44270753 CACAGCTGCAGGGGTGCACCAGG - Intronic
1184903322 22:47461515-47461537 GTGGGCTGCAGAGGTGGAGCTGG + Exonic
1185194769 22:49462130-49462152 GTGGCCTGGAGAGGTGCAGCCGG + Intronic
1185322746 22:50209429-50209451 GTGGACTGCAGGGATGGAGCTGG - Intronic
949405025 3:3705346-3705368 GAGTGCCGAAGGGGTGCAGTGGG - Intronic
949485767 3:4536138-4536160 GGAGGCTGCAGAGGTGCAACTGG + Intronic
950079835 3:10213431-10213453 GGAGGCTGCAGGGGTGGGGCGGG + Intronic
950282598 3:11720188-11720210 GAGGGCGGCGTGGGTGCCGCAGG - Intronic
950646874 3:14382638-14382660 CAGAGCTGGTGGGGTGCAGCAGG - Intergenic
950778683 3:15372792-15372814 GAGGGCAGCAGGGGTGGCTCTGG - Intergenic
952884476 3:38003986-38004008 GAGGGCTGCAGGGGTAGGGGAGG - Intronic
952885431 3:38008763-38008785 GAGGGTGGCAGGAGGGCAGCAGG - Intronic
953618988 3:44516439-44516461 TTGAGCAGCAGGGGTGCAGCTGG + Intergenic
954221555 3:49158092-49158114 GAGGGCTCAAGGTGAGCAGCTGG + Intergenic
954297369 3:49681744-49681766 GAGGGCTGCCAGGCTGCAGCAGG - Exonic
954303825 3:49715154-49715176 GAGGACAGCAGGTTTGCAGCAGG + Intronic
954422471 3:50425952-50425974 GGGGGTTGCTGGGGAGCAGCTGG - Intronic
954538501 3:51378851-51378873 CATGGATGCAGGGGTGCAGTGGG - Intronic
954711365 3:52506608-52506630 CTGGGCTGCAGGGGTGGAGGTGG + Intronic
955034625 3:55254575-55254597 GGGGGATGCAGGGGTGAGGCGGG + Intergenic
955326168 3:58010433-58010455 GAGGGCTGCTGGAGATCAGCTGG - Intronic
955888492 3:63625657-63625679 GGGGGCAGCAGGGGTGCAGAGGG - Intergenic
955911663 3:63864180-63864202 CAGGGCTGCGGGGGTGCGGCGGG + Intergenic
956467776 3:69536145-69536167 GAGGCCAGCAGAGGTGCAGAAGG - Intronic
957215760 3:77317740-77317762 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215789 3:77317809-77317831 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215803 3:77317842-77317864 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
957215814 3:77317865-77317887 GGGGGCTGCTGGGGGGCTGCTGG + Intronic
959905161 3:111703212-111703234 GAGGGATGCAGGGATGGTGCTGG + Intronic
960685641 3:120290776-120290798 GATGGCTTCAGGAGTGAAGCTGG - Intergenic
961126745 3:124425524-124425546 GAGGTCAGCAGGGCTCCAGCAGG + Intronic
961211510 3:125129421-125129443 GGTGGCTGCAGGGGTGGAGTGGG - Intronic
961458214 3:127034591-127034613 GAGGATGGCAGCGGTGCAGCGGG - Exonic
961550368 3:127667481-127667503 GAAGGCTGCTGGGGAGGAGCCGG + Intronic
961810388 3:129518637-129518659 GAGGCCAGCAGGGGTCCTGCAGG - Intronic
961816787 3:129555259-129555281 GGGGGCTGGAGGGGGGCAGCTGG - Exonic
961847601 3:129780415-129780437 GAGGGGTGGAGGGGTGGAGGTGG - Intronic
962682684 3:137816015-137816037 GAGGGCAGCAGGGGTGCCAGAGG - Intergenic
963128506 3:141836710-141836732 GAGGGATGCTGGGGTGCAAAGGG - Intergenic
963326226 3:143866311-143866333 GAGGGCTGTGGGGGTGAGGCAGG - Intergenic
963779277 3:149470861-149470883 GAGTCCTGGAGGGGTGTAGCAGG + Intergenic
964358300 3:155870404-155870426 GAGGGCAGGAGGGGCGGAGCCGG + Intergenic
964672692 3:159244434-159244456 GAGGACTGCAGGGGAGAAGGTGG + Intronic
964927964 3:161979594-161979616 GATGGCTGCAGTGGTCCATCTGG - Intergenic
966242409 3:177769115-177769137 GAGGAATCCAAGGGTGCAGCTGG - Intergenic
966890199 3:184401701-184401723 GAGGGCTGTAGGGCTGGAGGGGG + Intronic
968299277 3:197600873-197600895 GGGTGCTGCAGGGGAGCAGTTGG - Intergenic
968486877 4:867126-867148 CAGGCCTGCGGGGGTACAGCTGG + Exonic
968506873 4:974772-974794 GAGGGCTGCCTGGGGGCAGCAGG + Intronic
968611722 4:1560202-1560224 TAAGGCTGCCGGGGTGAAGCTGG - Intergenic
968615939 4:1577922-1577944 AGGGGCTGCGGGGGTGCAGGTGG + Intergenic
968666477 4:1825021-1825043 AAGGGGTGCAGGGCTCCAGCCGG - Intronic
968804583 4:2763998-2764020 GCGGGCAGCGGGGGTGCAGCGGG + Intergenic
968820273 4:2844310-2844332 GTGGGCTGCAGGGGTGGGGGCGG + Intronic
968894637 4:3391810-3391832 GAGGGCTGCCTGGGTGCTCCAGG + Intronic
969021332 4:4142312-4142334 TGGGCCTGCTGGGGTGCAGCTGG + Intergenic
969067259 4:4496383-4496405 GTTGGCTGCAGTGGTTCAGCAGG - Intronic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969446473 4:7247675-7247697 GAGTGCTGGAGGTGGGCAGCGGG + Intronic
969530306 4:7726762-7726784 AGGGGCTGCAGGGGCACAGCAGG - Exonic
969732530 4:8965104-8965126 CGGGCCTGCTGGGGTGCAGCTGG - Intergenic
969792109 4:9499187-9499209 CGGGCCTGCTGGGGTGCAGCTGG - Intergenic
969911261 4:10448638-10448660 GAGGCCTGCAGGGTTGCAGTGGG + Intronic
973696602 4:53496576-53496598 GAGGCCTGGAGAGGTGCTGCAGG - Intronic
975033909 4:69658216-69658238 GTGGACTCCACGGGTGCAGCTGG - Intergenic
975890858 4:79025212-79025234 GAGGCATGCACTGGTGCAGCTGG + Intergenic
976290641 4:83413964-83413986 GAATTCTGGAGGGGTGCAGCTGG - Intronic
977585371 4:98770211-98770233 GAAGGCTGCAGGGGTGGTGAGGG + Intergenic
978822413 4:112980453-112980475 GCTGGCTGCAGCGGTGCGGCCGG - Intronic
979495755 4:121380716-121380738 GAGGGCTTCGGGGGACCAGCCGG + Exonic
984560663 4:181265159-181265181 CAGGCCTGCAGTGGTGCAGCGGG + Intergenic
985586726 5:743448-743470 GAAGCCTGCTGGGGTTCAGCAGG + Intronic
985601309 5:835635-835657 GAAGCCTGCTGGGGTTCAGCAGG + Intronic
985852714 5:2400404-2400426 GAGAGTAGCAGGGCTGCAGCAGG - Intergenic
987983894 5:25121655-25121677 GAGGGCTCCATGCCTGCAGCGGG + Intergenic
988619217 5:32805259-32805281 GATGGCTGCAGTGGTACTGCTGG + Intergenic
992041460 5:72837365-72837387 CATGGCTGAAGGGGAGCAGCAGG + Intronic
994813739 5:104556983-104557005 TAGGCCTGCAGGTGTGCAGAGGG - Intergenic
997073212 5:130641816-130641838 GAGGGATGGAGAGGTGAAGCCGG + Intergenic
997377434 5:133407166-133407188 GAGGTTTGCAGGGCTGCAGAAGG + Intronic
998037585 5:138929970-138929992 GTGGGCTGGAGGTGGGCAGCAGG + Intronic
998364262 5:141618732-141618754 GCCGGCTGCAGGGGTCCAGAGGG + Intronic
999908045 5:156165131-156165153 GAGGGCTGCAGGAGTTCCGGAGG + Intronic
1001519682 5:172382097-172382119 GAGAGATGTAGGGGGGCAGCTGG + Exonic
1001570245 5:172726002-172726024 GAGGCCAGCATGGCTGCAGCGGG - Intergenic
1001661068 5:173393868-173393890 GATGTCTGCAGGGGTCCAACAGG + Intergenic
1001796487 5:174506473-174506495 GAGGGAAGCTGGGGTGCAGAGGG + Intergenic
1001867656 5:175119136-175119158 GAGGGCTGCATGGGAGCCCCAGG + Intergenic
1001972571 5:175968177-175968199 GAGGGCCCCATGGCTGCAGCGGG + Exonic
1002059003 5:176615302-176615324 GAGGGCTGCCAAGGAGCAGCTGG - Intergenic
1002163736 5:177332298-177332320 GGGGGCTGCAGGAGGGCAGTGGG + Intronic
1002244870 5:177875604-177875626 GAGGGCCCCATGGCTGCAGCGGG - Intergenic
1002490069 5:179569541-179569563 GAGGACCCCAGGGATGCAGCTGG + Intronic
1002777646 6:342411-342433 GCTGGCTGCAGGGGTGCAGCTGG - Intronic
1002777806 6:343389-343411 GCTGGCTGCAGGGGTGCAGCTGG + Intronic
1002778434 6:348408-348430 GACTTCTGAAGGGGTGCAGCTGG - Intronic
1002799799 6:511596-511618 GAGGGCTGCACGGGGGCATCTGG + Intronic
1004883119 6:20028140-20028162 GAGGGCTGCTAGGGTGGAGCAGG - Intergenic
1005625277 6:27656594-27656616 AAGGGCTGAAGGGGAGCAGATGG + Intergenic
1006338312 6:33432229-33432251 GAGGGCCGGAAGGGCGCAGCAGG - Exonic
1006509864 6:34515903-34515925 GTGGGGTGCAGGGGAGGAGCTGG + Intronic
1006953837 6:37849148-37849170 GGGGGCTGCAGGGGGCCAGAAGG + Intronic
1007112384 6:39320376-39320398 GAGGGCTGCAGGCTGGCAGTGGG - Intronic
1007633269 6:43284239-43284261 GCGGGCTGCTGGGCTGCAACAGG - Exonic
1011657442 6:89564581-89564603 AATGGATGCAGGGGTCCAGCTGG - Intronic
1013974720 6:116064165-116064187 GGAGGATGCAGAGGTGCAGCAGG - Intergenic
1015252582 6:131142583-131142605 GAGGGCTCCACTGCTGCAGCAGG - Intronic
1015525050 6:134167999-134168021 CAGGGTAGCGGGGGTGCAGCAGG + Intergenic
1016244378 6:141965383-141965405 GAGGTATGCAGGTGTGGAGCAGG - Intergenic
1016904841 6:149138152-149138174 GAGCACTGCAGGGAGGCAGCAGG + Intergenic
1017768542 6:157626821-157626843 GAGGGCTGCACAGGTGTATCGGG - Intronic
1018945647 6:168345708-168345730 GGGGGCAGCCGGGGGGCAGCTGG + Intergenic
1018945662 6:168345740-168345762 GGGGGCAGCCGGGGGGCAGCTGG + Intergenic
1018978198 6:168581773-168581795 GGGGGCTGCAGGGAGGCAGCGGG - Intronic
1019017541 6:168890801-168890823 GAGGGCTTCAGGGGCTCAGGAGG + Intergenic
1019274298 7:167654-167676 GAGGGCTGCGGTGGCCCAGCGGG + Intergenic
1019368320 7:646920-646942 GAGGGCGGCAGCGGTACACCTGG + Intronic
1019477482 7:1251044-1251066 GAATGCTGAGGGGGTGCAGCTGG + Intergenic
1019702462 7:2480532-2480554 GAGCTCTGCAGAGGGGCAGCGGG + Intergenic
1019917634 7:4143893-4143915 AAGCGTTGCAGGGATGCAGCAGG + Intronic
1019919842 7:4156541-4156563 GAGGGCTGCAGTGGAAAAGCAGG + Intronic
1020017809 7:4841669-4841691 GAGGGTTGCTGGGGTGAAGCAGG - Intronic
1020030905 7:4932037-4932059 CAGGGCTGCAGGCCTGCACCTGG - Intronic
1020140827 7:5610684-5610706 GAGGCCTGGAGGGGTGGGGCGGG + Intergenic
1020220499 7:6232937-6232959 GAGGGCTGCAGGGAGGTAGGAGG - Intronic
1020308755 7:6854341-6854363 CGGGCCTGCTGGGGTGCAGCTGG + Intergenic
1021482017 7:21128661-21128683 GTGTGCTTCAGGGCTGCAGCTGG + Intergenic
1022521987 7:31014355-31014377 GAGGGCTGCAGAGTTGCAGAAGG - Intergenic
1022532269 7:31074462-31074484 GAGGGCTGCAGAGGTCGGGCGGG - Intronic
1022833786 7:34094474-34094496 GAGGCAGGCAGGGGAGCAGCAGG + Intronic
1023035959 7:36131509-36131531 GAGAGCTACAGGGGTGGAGCAGG + Intergenic
1023908119 7:44536455-44536477 GAGGGAGGCACGGGTGCAGCAGG - Intronic
1023940383 7:44765522-44765544 GGGGGCTGCAGGGGGGCAAAGGG - Exonic
1024598034 7:50956211-50956233 GGGGGCTACAGGGGTGCTGGGGG + Intergenic
1026438008 7:70416817-70416839 GAGGGGAGCAGGGGTGCAGGAGG - Intronic
1026557022 7:71417426-71417448 GAGGGCTGAAGACATGCAGCTGG - Intronic
1027199971 7:76057780-76057802 GAGGTCTGCATGGGTGGAGCAGG - Intronic
1029157173 7:98525588-98525610 CAGGGCTTCAGGGCTGCTGCTGG + Intergenic
1029287868 7:99478630-99478652 GAGGGCTGCAGTGGTGTGGGAGG + Intronic
1029546501 7:101212974-101212996 GAGGCCTCCAGGGGTGGAGGTGG + Intronic
1029640128 7:101815591-101815613 GAGGGCTGCGGGGGTGGGGGGGG - Intergenic
1031986375 7:128167015-128167037 AAGCCCTGCAGGGGTCCAGCCGG - Intergenic
1032391342 7:131556874-131556896 GGGGGCTCCTGCGGTGCAGCCGG + Intronic
1033597177 7:142866393-142866415 GAGGGCGGCAGGGGTGGACCAGG - Intronic
1033619720 7:143051324-143051346 GAGAGCAGAAAGGGTGCAGCAGG - Intergenic
1033784838 7:144717995-144718017 GAGGGCTCCAGCCCTGCAGCAGG - Intronic
1034013493 7:147556555-147556577 GAGAGTTGCAGTGATGCAGCAGG + Intronic
1034275675 7:149822831-149822853 GGGGGGAGCAGGGGAGCAGCTGG - Intergenic
1034415685 7:150963224-150963246 GAGGGCGGAGGGGGTGCAACAGG + Intronic
1034422122 7:150995783-150995805 GAGGGGTGCAGGGGTGGGTCGGG - Intronic
1034422137 7:150995816-150995838 GAGGGATGCAGGGGTGGGACGGG - Intronic
1034422256 7:150996113-150996135 GAGGGGTGCAGGGGTGGGGTAGG - Intronic
1034422330 7:150996310-150996332 GAGGGGTGCAGGGGTGGAACAGG - Intronic
1034439733 7:151080642-151080664 GAGGGCTGCGGGAGGGCAGCGGG - Intronic
1034983110 7:155490936-155490958 GGGTGCTGCAGGGGGGCAGAGGG - Intronic
1035817848 8:2561049-2561071 GAAGGATGCAGAGGTTCAGCGGG - Intergenic
1036043974 8:5119339-5119361 TAGGACTGCAGGTGTGCACCTGG + Intergenic
1036224519 8:6946249-6946271 GAGGCATGCAGGGGTTAAGCTGG + Intergenic
1036613558 8:10371073-10371095 GATTGCGGCAGGGGTGCAGTGGG - Intronic
1036648477 8:10626456-10626478 AAGAGCTGCAGGCATGCAGCAGG + Intronic
1037898852 8:22675922-22675944 CAGGGCTGGAGGGTTGCAGCCGG - Intergenic
1037913758 8:22759534-22759556 CAGGGCTGCGGGGCTGCAGCTGG + Intronic
1038737308 8:30182799-30182821 CAGGGCGGCAGGGGTGCAGGTGG - Intronic
1039608410 8:38901153-38901175 GAGGGGTGCCGGGGCGCCGCGGG - Intergenic
1040300858 8:46187335-46187357 GAGGGCTGCAGGGACTCAGGGGG - Intergenic
1040313824 8:46250497-46250519 GCGGGCTGCAGGGATTCAGTGGG + Intergenic
1040315684 8:46259666-46259688 GAGGGCTGCAGGGATTCAAGGGG + Intergenic
1040325499 8:46339452-46339474 GCGGGCTGCAGGGGCTCAGGGGG + Intergenic
1040331922 8:46390032-46390054 GAGGGCTGCAGGGACTCAGAGGG + Intergenic
1040337051 8:46421328-46421350 GAGGGCTGCAGGGACTCAGAGGG + Intergenic
1040593833 8:48819311-48819333 GATGTCTGCAGGGGTGCATCTGG + Intergenic
1040644454 8:49382106-49382128 GATGACTCCAGGGGTGCACCTGG - Intergenic
1040963978 8:53065562-53065584 CAGGGCCGCCGGGGTGGAGCCGG - Intergenic
1041787380 8:61649773-61649795 GGGGGATGCAAGAGTGCAGCTGG - Intronic
1042753193 8:72180977-72180999 GAAAGCGGCAGGGGTGCAGGTGG - Intergenic
1044727243 8:95203613-95203635 AAGGGGTGCAGGGGTGGAGTGGG + Intergenic
1046853373 8:119001066-119001088 GTGAGCTTCAGGGGTGCAGTTGG + Intronic
1047499106 8:125429131-125429153 CAGGGCTGCCCGGGTGCAGGCGG + Intergenic
1047863341 8:128993295-128993317 GAGGGCTGAACTGGTGCAGAAGG + Intergenic
1048019891 8:130528375-130528397 GTGGGCTGCGGGGGTGGGGCTGG - Intergenic
1048275935 8:133065941-133065963 GAGGGGTGCAGAAGTGCTGCTGG + Intronic
1049261032 8:141639324-141639346 GAGGGGTGCAGGGGGGAGGCTGG + Intergenic
1049306538 8:141907099-141907121 CAGGGCTGGAGGGGAGGAGCTGG - Intergenic
1049756475 8:144313313-144313335 GTGCCCTGCAGGGGTGCGGCTGG - Intronic
1049867059 8:144946123-144946145 CTGGGCTGCAGGGGTCCAGGGGG + Exonic
1050495785 9:6240331-6240353 GTGGGGTGGAGGGGTTCAGCTGG + Intronic
1050911635 9:11078829-11078851 GGGGCCTGTAGGGGTGCAGGGGG + Intergenic
1051606267 9:18920447-18920469 GAGGGCTGAAGGGGTGGGGTGGG - Intergenic
1052991469 9:34521458-34521480 GGGGCCTTCAGGGCTGCAGCAGG + Exonic
1053351187 9:37414405-37414427 GTGGGGTGCAAGGCTGCAGCAGG + Intergenic
1053455356 9:38229317-38229339 GAGGGATGCAGGGTTGGGGCGGG + Intergenic
1055216800 9:73873285-73873307 GAGGGGTGCAGGTGTGCTGCAGG - Intergenic
1055315247 9:75028174-75028196 GAGGGCTGCGGGGGAGGAGGCGG - Exonic
1056021285 9:82440891-82440913 GAGGGCTCCAGCCCTGCAGCAGG - Intergenic
1057455169 9:95202203-95202225 GAAGGCTCCAGGGGTGCTGCTGG + Intronic
1057492700 9:95534255-95534277 GAGGCCTGAAGGGGTGCTGTGGG + Intergenic
1059218930 9:112593534-112593556 CAGGGATGGAGGGGTGCAGTGGG + Intronic
1059304072 9:113340219-113340241 GTGGGCTGCGGGGCTGGAGCTGG + Exonic
1060000814 9:119957121-119957143 GAGGGCTGGGGGGGTGGAGCAGG - Intergenic
1060414702 9:123421996-123422018 GAGGGATGCAGGGATCCATCAGG - Intronic
1060522023 9:124299326-124299348 GAGGGGTCTAGGGGTGCAGCTGG + Intronic
1060827621 9:126695770-126695792 GGAGGCTGCTGGGGTGTAGCTGG + Intronic
1061108899 9:128552880-128552902 GTGGGCTGCGGAGGAGCAGCCGG + Intronic
1061132161 9:128714264-128714286 GGGAGCTGCAGGGGGGCAGCAGG - Exonic
1061295655 9:129675491-129675513 GAGGGTAGCAGGGGGGCAGGAGG - Intronic
1061579743 9:131529748-131529770 GTGGTCTGCAGGGCTGCAGAGGG - Intronic
1061701922 9:132422623-132422645 GGGGGCTGCAGTGAAGCAGCAGG + Intronic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1061865631 9:133490649-133490671 GAGGCGTGCAGGGGTGCTGTCGG + Intergenic
1061885524 9:133589435-133589457 GAGGGCTCCAGGGGTGAACATGG + Intergenic
1061994843 9:134178136-134178158 GAGGGCCCGAGGGGTGCAGCTGG - Intergenic
1062067570 9:134537057-134537079 GAGAGTGGCACGGGTGCAGCAGG + Intergenic
1062254485 9:135614629-135614651 GAAGGCTGCAGGGCGGCAGCCGG + Intergenic
1062270714 9:135707160-135707182 ATGGCCTGCAGGGGTGCACCGGG - Intronic
1062337032 9:136075900-136075922 GAGGGCTGCGGGGCTGCTCCTGG - Intronic
1062343548 9:136104339-136104361 GCAGGCTGCAGGGGTGGAGGGGG - Intergenic
1062462113 9:136666357-136666379 GGGGGCTGCGGGGCTGCTGCCGG + Intronic
1062522469 9:136963987-136964009 GTGGGCTGCAGGGCTGGGGCTGG + Intergenic
1062569532 9:137178768-137178790 GAGGCCTGGAGGGAGGCAGCAGG + Intronic
1062612088 9:137379964-137379986 GAGGCTGGCAGGGGTGCAGTGGG - Intronic
1062624385 9:137436303-137436325 CAGGGCCGCAGGTGTGCGGCTGG - Intronic
1062633767 9:137479091-137479113 GCGGGCAGCAGAGGTGCAGGTGG + Exonic
1062664053 9:137657368-137657390 GTTGGCTGCAGGGGTGCAGCAGG + Intronic
1185469932 X:376309-376331 AAGGGCTCCAGGGGGGCAGTGGG - Intronic
1185611988 X:1398487-1398509 GGGGGCCGCATGGTTGCAGCAGG - Intergenic
1185831822 X:3310219-3310241 GAGGGGTGCAGGGGAGCTTCAGG + Exonic
1187774773 X:22744078-22744100 AAGGGCTGCAGGGAAGCAGAAGG - Intergenic
1187969798 X:24647842-24647864 GAGGGCTCCAGGGCTACACCAGG - Intronic
1189330362 X:40141101-40141123 GAGGGCTGCCAAGGGGCAGCAGG + Intronic
1189738673 X:44096840-44096862 GAGGGCTACAGTGGTGGGGCAGG - Intergenic
1189964171 X:46354644-46354666 GAGGGCTGCAGGGAAGAAGAAGG + Intergenic
1190789646 X:53686683-53686705 GAGGGGAGCAGGGCTGGAGCAGG - Intronic
1191109923 X:56796306-56796328 GAGTGCTCCAGGTGGGCAGCTGG - Intergenic
1192232857 X:69278018-69278040 GAGGCCTGCAGTGGGGCAGCTGG - Intergenic
1196892863 X:120307857-120307879 GAGGGCTGCAGTAGTTCTGCAGG - Intronic
1197346278 X:125327781-125327803 GAGAGCTGCAGAGGTGCAGCTGG + Intergenic
1198424118 X:136497538-136497560 GGGGACTGCTGGGGCGCAGCGGG + Intronic
1199607155 X:149586281-149586303 GCTGGCAGCAGGGGTGCTGCTGG + Intronic
1199631967 X:149783087-149783109 GCTGGCAGCAGGGGTGCTGCTGG - Intronic
1200251656 X:154557304-154557326 GGAGGCTGGAGAGGTGCAGCCGG - Intronic
1200253863 X:154568988-154569010 GGAGGCTGGAGAGGTGCAGCCGG - Intergenic
1200263906 X:154635420-154635442 GGAGGCTGGAGAGGTGCAGCCGG + Intergenic
1200266111 X:154647112-154647134 GGAGGCTGGAGAGGTGCAGCCGG + Intergenic
1201244182 Y:11986861-11986883 GAGGGGTGCAGGGGAGCTTCAGG - Intergenic