ID: 903720931

View in Genome Browser
Species Human (GRCh38)
Location 1:25405108-25405130
Sequence AGTACTTTTCGGAGCCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8364
Summary {0: 1, 1: 1, 2: 9, 3: 312, 4: 8041}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903720926_903720931 12 Left 903720926 1:25405073-25405095 CCTGTGGTCTCAGCTACTCAGGA 0: 363
1: 7447
2: 61326
3: 181370
4: 227197
Right 903720931 1:25405108-25405130 AGTACTTTTCGGAGCCGAGGTGG 0: 1
1: 1
2: 9
3: 312
4: 8041

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903720931 Original CRISPR AGTACTTTTCGGAGCCGAGG TGG Intronic
Too many off-targets to display for this crispr