ID: 903721706

View in Genome Browser
Species Human (GRCh38)
Location 1:25410549-25410571
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903721706_903721710 1 Left 903721706 1:25410549-25410571 CCTCCTGTGCTTCAGTGGGAACC 0: 2
1: 0
2: 0
3: 10
4: 146
Right 903721710 1:25410573-25410595 CAGGCGCGCACCACCACGCCTGG 0: 176
1: 6789
2: 39099
3: 106930
4: 182819
903721706_903721712 12 Left 903721706 1:25410549-25410571 CCTCCTGTGCTTCAGTGGGAACC 0: 2
1: 0
2: 0
3: 10
4: 146
Right 903721712 1:25410584-25410606 CACCACGCCTGGCTAATTTTTGG 0: 132
1: 636
2: 1078
3: 1323
4: 1511
903721706_903721715 21 Left 903721706 1:25410549-25410571 CCTCCTGTGCTTCAGTGGGAACC 0: 2
1: 0
2: 0
3: 10
4: 146
Right 903721715 1:25410593-25410615 TGGCTAATTTTTGGCCAAGCTGG 0: 2
1: 0
2: 4
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903721706 Original CRISPR GGTTCCCACTGAAGCACAGG AGG (reversed) Intronic
900252375 1:1677885-1677907 GATTCCCACTGGACCTCAGGAGG - Intronic
900469331 1:2845334-2845356 GGTTCCCCCAGAGGCACTGGAGG - Intergenic
901174786 1:7291087-7291109 GGTGCTCAGTGAAGCACTGGTGG + Intronic
903705524 1:25282771-25282793 GGTTCCCACTGAAGCACAGGAGG + Intronic
903721706 1:25410549-25410571 GGTTCCCACTGAAGCACAGGAGG - Intronic
904609791 1:31719307-31719329 GGCTCTCACTGTGGCACAGGAGG - Intergenic
905105233 1:35559828-35559850 GGCTCACACTGCAGCAGAGGAGG + Intronic
907264759 1:53250830-53250852 GGTATCCACTCATGCACAGGAGG + Exonic
907511871 1:54967465-54967487 GGTTCCCACTTGATCACAGCTGG + Intergenic
909481347 1:76131283-76131305 GGATCCCACTGAAGAACAAGTGG - Intronic
912059565 1:105649746-105649768 TTTTGCCACTGAAGCATAGGAGG - Intergenic
913439176 1:118879091-118879113 GGTTCCCATTGAGACACTGGAGG + Intergenic
915141879 1:153773068-153773090 GGTTCTCACTGAAGCACTGCTGG - Exonic
915346026 1:155197371-155197393 GGTTCCCAGTCAAGCAGTGGGGG + Intronic
924001091 1:239553358-239553380 GGTTCCCACGGAAGCATAGTAGG - Intronic
924809578 1:247389359-247389381 GTTACGCACTGAAACACAGGAGG - Intergenic
1062786697 10:270997-271019 GGTTCACCCTGAAGCTGAGGAGG - Intergenic
1063437980 10:6049959-6049981 GGTTCCCTTTGAAGGACAGGAGG + Intronic
1065344622 10:24737074-24737096 GGGCCCAACTGAAGCACAGGAGG + Intergenic
1066491777 10:35901158-35901180 AGGATCCACTGAAGCACAGGTGG + Intergenic
1070819363 10:79346002-79346024 GGCACCCAGTGAAGCCCAGGTGG - Intergenic
1074864506 10:117537072-117537094 GGTTTCCAGTGAAGCCCAAGCGG + Intergenic
1075650974 10:124128252-124128274 GGGTCCCACTGCTGCTCAGGGGG - Intergenic
1078554431 11:12309338-12309360 GGTTACCACGGAAGCAGAAGTGG - Intronic
1083769676 11:64859605-64859627 AGTTACCGCTGAAGCAAAGGAGG - Intronic
1083927285 11:65815726-65815748 GGGTCCCACAGAAGCTCAAGAGG - Intergenic
1084519943 11:69656951-69656973 GGTCTCCACTGAATCCCAGGAGG - Intronic
1088424897 11:109692676-109692698 GGGACCCTCTGAAGCACAGAAGG + Intergenic
1088995252 11:114990235-114990257 GGTTACCACTTGAGCACAGGGGG - Intergenic
1089668561 11:120035777-120035799 GGTTCCCTGAGAAGCAGAGGAGG - Intergenic
1090157763 11:124459639-124459661 GGTTGCCACTGGGGCTCAGGCGG - Intergenic
1091606882 12:1960340-1960362 TGAACCCACTGAAGCACAGTAGG + Intronic
1092109220 12:5947071-5947093 GGCTACCACTGCAGCATAGGTGG - Intergenic
1093362352 12:18246243-18246265 GCTTCCCAATGAAGCATAGCTGG + Intronic
1102426896 12:112850784-112850806 GGCTCCCACTGCAGAACATGAGG + Intronic
1102445856 12:113002313-113002335 TGCTCCCTCTGAAGCACACGTGG - Intronic
1102709273 12:114911150-114911172 GGTTCAAAGTGAAGCAAAGGTGG - Intergenic
1103138474 12:118528026-118528048 TGATCCCCCTGAAGGACAGGAGG + Intergenic
1103324456 12:120111188-120111210 CGCTCCCACTGCAGCACAGCAGG + Intronic
1103413222 12:120727138-120727160 GTTTCCCATTGCAGCCCAGGTGG + Exonic
1103660718 12:122513805-122513827 GGTTCCCAGGGAAGCACATCAGG + Intronic
1104014325 12:124952270-124952292 GGTCCCCACTGAGGAACAAGTGG - Intronic
1105923661 13:24987209-24987231 GCCTCCCACTGAGACACAGGAGG + Intergenic
1110842540 13:80158862-80158884 GGCTGGCACTGATGCACAGGTGG - Intergenic
1113562066 13:111289370-111289392 TGTTGCCAGTGAAGCACAGCAGG + Intronic
1113765286 13:112877256-112877278 AGTTTCCCCTGAAGCACTGGGGG - Intronic
1119749948 14:77070089-77070111 TGATGCCACTGAGGCACAGGAGG + Intergenic
1119910968 14:78348892-78348914 GGTGCCCACTGGAGCACTTGGGG - Intronic
1122138769 14:99649915-99649937 GGTTCCCAGTGAACCATGGGAGG + Intronic
1123027351 14:105432954-105432976 GCTTTCGACTGAAGCTCAGGCGG - Intronic
1128498588 15:68211734-68211756 GGTAGCCACTGAAGAGCAGGCGG + Exonic
1132067717 15:98745970-98745992 GTCTCCCACTGAAGAACACGTGG - Intronic
1133211910 16:4267983-4268005 GGTTCCCACTGATGGGCTGGAGG - Intronic
1134710488 16:16324996-16325018 GGTCCCCACGGCATCACAGGAGG - Intergenic
1135185473 16:20311756-20311778 GTTTCCCACTAAATCACTGGGGG - Intronic
1139069493 16:63362893-63362915 GATTCTCAGTGAAGAACAGGAGG - Intergenic
1140949428 16:79802126-79802148 TCTGCCCACTGAACCACAGGTGG + Intergenic
1144449485 17:15364323-15364345 AGTTCCCACCCAAGCACAGGTGG - Intergenic
1145258784 17:21342537-21342559 GGTTCCCAGAGAGGCCCAGGAGG - Intergenic
1145317840 17:21745467-21745489 GGTTCCCAGAGAGGCCCAGGAGG + Intergenic
1148697588 17:49570452-49570474 TGTCCCCAGTGAAGCACTGGCGG - Intergenic
1150712560 17:67544374-67544396 CCTTCCCACTGAAGCCCAGGAGG + Intronic
1151575433 17:74950640-74950662 GGTTCCCAGTCATGCACTGGGGG + Intergenic
1152008229 17:77695589-77695611 GGTTCCCACTGAGGCTCTGAGGG + Intergenic
1152693218 17:81730970-81730992 TGTGCCCAGTGAAGCAGAGGTGG + Intergenic
1157595539 18:48861536-48861558 AGGGGCCACTGAAGCACAGGTGG - Exonic
1159439065 18:68454762-68454784 TGTTCTCACTGAACCCCAGGTGG + Intergenic
1160011831 18:75111889-75111911 GGTGCCCTCGGCAGCACAGGTGG + Intergenic
1163547429 19:17948391-17948413 GGTTCCCCCTCGAGCACCGGGGG + Intergenic
1163692011 19:18743290-18743312 GGTTCCCGCTGCCGCACAGCCGG - Intronic
1163849823 19:19656560-19656582 GGATCCCCCTCAGGCACAGGCGG - Intronic
1164633229 19:29775151-29775173 GGATCCCAGTGAAGCACTGTGGG - Intergenic
1166231506 19:41427719-41427741 GGGTCCCACTGAGGCAGAGATGG + Intronic
1167153681 19:47725139-47725161 GGGTTCCATAGAAGCACAGGGGG + Intronic
1167923240 19:52801725-52801747 GGTTTCCAATGAAGTACAGATGG + Intronic
928028231 2:27756937-27756959 GGCAACCACTCAAGCACAGGGGG - Intergenic
935232572 2:101111696-101111718 GATTCACACTGAATTACAGGAGG + Intronic
935615955 2:105082145-105082167 TGTCCCCACTGCAGCACGGGAGG + Intronic
937223102 2:120353336-120353358 GGTGACCACAGCAGCACAGGAGG - Intergenic
939250658 2:139677780-139677802 GGTAACAACTGAAGCACCGGTGG - Intergenic
939419185 2:141943978-141944000 GGTTCCCACAGGGGAACAGGAGG + Intronic
939773962 2:146361306-146361328 AGAACCCACAGAAGCACAGGGGG + Intergenic
940998142 2:160172384-160172406 GGTTCCCACCAGAGCATAGGTGG - Intronic
941081650 2:161068299-161068321 GTTTCCCAGAGCAGCACAGGAGG - Intergenic
942417131 2:175771213-175771235 GGCTCACACTGAAGCACAAAAGG + Intergenic
942870105 2:180724513-180724535 TGTTCCTTCTGAAGCACAGATGG + Intergenic
945468067 2:210194068-210194090 ATTTCACACTGAAACACAGGAGG - Intronic
946228780 2:218279086-218279108 GGTTCCCTGTGGGGCACAGGAGG + Exonic
1170538469 20:17364892-17364914 GGTTGCCACTGGAGCTCAGCTGG + Intronic
1171785999 20:29465168-29465190 GGTTCCCACTGTAGGAGATGGGG + Intergenic
1175924277 20:62464407-62464429 GATTCCCAGTGAAGCACCTGAGG - Exonic
1180135631 21:45860089-45860111 GTTACCCACTGAAGTCCAGGAGG - Intronic
1181962889 22:26635693-26635715 GGGTCCTACTGAAGTACTGGGGG + Intergenic
1183650271 22:39149609-39149631 GTTTCCCCCTGGACCACAGGAGG - Intronic
1184368556 22:44068251-44068273 GATTCCCACAGCAGCACATGAGG + Intronic
1184579150 22:45401688-45401710 GGTCCACAGTGAAGTACAGGCGG - Intronic
1184692226 22:46122621-46122643 GGTGCCCAATGAAGCACGTGGGG + Intergenic
949930837 3:9077238-9077260 GGTGCTCACTGAAGCAAAGGAGG - Intronic
950895574 3:16447538-16447560 GGTTCCCACTAAAGAAAACGGGG + Intronic
951128593 3:19014134-19014156 GGTTACTACTGAGGCACAGCAGG + Intergenic
955382176 3:58448162-58448184 GGATCACACTTAAGCCCAGGAGG + Intergenic
957878988 3:86185526-86185548 GATTGACACTGAAGCAAAGGCGG + Intergenic
959005779 3:101018251-101018273 GGTTCCCACTTTAGCAAAGTAGG - Intergenic
959900652 3:111657863-111657885 GATTACCAGTGAAGGACAGGTGG - Intronic
963580695 3:147123154-147123176 GGTATCTACTTAAGCACAGGAGG - Intergenic
968429169 4:545117-545139 GCTTCGCCCTGCAGCACAGGTGG + Intergenic
968980217 4:3844021-3844043 GGTTGTCACTGAAGCAGAAGCGG + Intergenic
973056402 4:45664811-45664833 GTTTTCCTCTGAAACACAGGTGG - Intergenic
975446360 4:74470013-74470035 GGCTCCCCTTGAAGCACAGTGGG + Intergenic
977570837 4:98627644-98627666 TGTTCCCACTGAAATCCAGGGGG - Intronic
984866092 4:184281990-184282012 GGATGCCACTGAAGGACTGGAGG - Intergenic
986225443 5:5807583-5807605 GATTCCCATGGAAACACAGGGGG - Intergenic
987151155 5:15041392-15041414 AGGTCCCACTCAAGCACATGAGG - Intergenic
994913135 5:105939130-105939152 GGTTCCCACACTAGAACAGGAGG + Intergenic
995123910 5:108561279-108561301 GATTCCCACTGTAGCATATGAGG - Intergenic
997487899 5:134247179-134247201 AGTTCCCACTGAAGGACACCAGG + Intergenic
997706975 5:135964837-135964859 TCTTTCCACTGAAACACAGGAGG - Intergenic
998428387 5:142049205-142049227 AGGTCCCACTGTTGCACAGGTGG + Intergenic
999983082 5:156976506-156976528 AGTTCCCACTGGAGCTCAAGTGG - Intergenic
1001137713 5:169116306-169116328 GGTTCCCACGGAAGAAGAGTGGG + Intronic
1001763869 5:174229592-174229614 GGTACCCAATGAAACACTGGAGG - Intronic
1002599019 5:180343417-180343439 GGTGCCCACTCAGGCACAGCAGG + Intronic
1003400549 6:5786989-5787011 GCCTCCCACTGAGACACAGGAGG + Intergenic
1004147939 6:13087673-13087695 GTTTCCCACTGTTGCACAGGTGG + Intronic
1004321041 6:14631696-14631718 CCTTCCCTCTGAAGCCCAGGGGG + Intergenic
1005928796 6:30465629-30465651 GATTCGTACAGAAGCACAGGAGG - Intergenic
1017925441 6:158908233-158908255 GGTCCACAGTGAAGCGCAGGAGG - Intronic
1020761347 7:12270668-12270690 GGCTCCCTATGAAGCACAGCTGG - Intergenic
1022522108 7:31015095-31015117 GCTTCTCACTGAGGCCCAGGTGG - Intergenic
1023227346 7:37984481-37984503 GCTTCCCACTAAAACACAGCAGG - Intronic
1023999298 7:45180375-45180397 GGTCCCCACTGAAGCAGGGTGGG + Intronic
1027113819 7:75462514-75462536 GGTTCCCACTGAACCATGGAAGG - Intronic
1027286071 7:76647119-76647141 GGTTCCCACTGAACCATGGAAGG - Intergenic
1027735063 7:81921070-81921092 GATGCCCGCTGCAGCACAGGAGG - Intergenic
1029442778 7:100596412-100596434 GGGTCTCACTAAAGCACAGAAGG + Intronic
1038358932 8:26858193-26858215 TGTTGCCACTGAATCAAAGGAGG - Intronic
1041738353 8:61134262-61134284 GGGCCCCACTGAGGCACTGGAGG - Intronic
1043522844 8:81064684-81064706 GGTTTCTACTGAAGCAGAGACGG + Intronic
1044003228 8:86910864-86910886 GGTCCCCAGTGAAGTGCAGGAGG + Intronic
1046997610 8:120541920-120541942 TATTACCACTGAACCACAGGAGG - Exonic
1049465795 8:142750774-142750796 TGTTCCCACCGAAGGACATGAGG + Intronic
1051434513 9:17016803-17016825 GGTTCCCACACAGGAACAGGAGG + Intergenic
1052848036 9:33354599-33354621 AGGTCCCTCTGAAGGACAGGTGG - Intronic
1053462737 9:38283021-38283043 GGGTCCCACTGAAACAGAAGAGG + Intergenic
1056920150 9:90780289-90780311 GCGTCCCACTGAGGGACAGGAGG - Intergenic
1059504811 9:114788891-114788913 TGAACCCACTGAAGCACAGAAGG + Exonic
1060090078 9:120735038-120735060 GATTCTCACTGAAGCCCAGCAGG - Intergenic
1061925530 9:133804423-133804445 GGTTCCCGCTGAGGAACAGCGGG - Intronic
1062340966 9:136093916-136093938 GTGTCCCACTGGAGAACAGGAGG + Intronic
1203441683 Un_GL000219v1:15577-15599 GGCGCCCACTGAAGCCCTGGCGG - Intergenic
1203446816 Un_GL000219v1:64396-64418 GGTTCCCACTGTAGGAGATGGGG + Intergenic
1187506215 X:19880592-19880614 GGCTCCCACAGATGCACAAGCGG + Intronic
1188055475 X:25536050-25536072 GGTTTCCATGGAAGCAAAGGTGG + Intergenic
1190573963 X:51814326-51814348 TGTTGCAACAGAAGCACAGGTGG - Intronic
1192175395 X:68881833-68881855 GGTTCCCAATGATGCTAAGGGGG + Intergenic
1198957527 X:142148790-142148812 GGTTCCCACTGATGATGAGGAGG - Intergenic
1201778999 Y:17697644-17697666 GGATCCCACTGAGGCCCATGGGG - Intergenic
1201822557 Y:18208348-18208370 GGATCCCACTGAGGCCCATGGGG + Intergenic