ID: 903722070

View in Genome Browser
Species Human (GRCh38)
Location 1:25413132-25413154
Sequence GTGTAGAGCCTTGGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 2, 1: 0, 2: 3, 3: 20, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903722070_903722080 25 Left 903722070 1:25413132-25413154 CCTTCCTCCCCAAGGCTCTACAC 0: 2
1: 0
2: 3
3: 20
4: 246
Right 903722080 1:25413180-25413202 CAGCCAACAAGATGAAATTAGGG 0: 2
1: 0
2: 4
3: 22
4: 222
903722070_903722079 24 Left 903722070 1:25413132-25413154 CCTTCCTCCCCAAGGCTCTACAC 0: 2
1: 0
2: 3
3: 20
4: 246
Right 903722079 1:25413179-25413201 TCAGCCAACAAGATGAAATTAGG 0: 2
1: 1
2: 0
3: 16
4: 181
903722070_903722075 -8 Left 903722070 1:25413132-25413154 CCTTCCTCCCCAAGGCTCTACAC 0: 2
1: 0
2: 3
3: 20
4: 246
Right 903722075 1:25413147-25413169 CTCTACACTGTCCCTGAGAGAGG 0: 2
1: 0
2: 2
3: 9
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903722070 Original CRISPR GTGTAGAGCCTTGGGGAGGA AGG (reversed) Intronic
900608115 1:3532790-3532812 GGGTAGAGCTGTGGGGAAGAAGG + Intronic
901137270 1:7006032-7006054 GTGTGGAGCATTTGGAAGGATGG + Intronic
903302304 1:22388073-22388095 GTGGTGAGACATGGGGAGGAGGG - Intergenic
903705155 1:25280189-25280211 GTGTAGAGCCTTGGGGAGGAAGG + Intronic
903722070 1:25413132-25413154 GTGTAGAGCCTTGGGGAGGAAGG - Intronic
905624440 1:39478315-39478337 TTGTTGAGGCTTGAGGAGGAAGG + Intronic
905706946 1:40067620-40067642 TGGTAGAGACTGGGGGAGGAGGG - Exonic
909746996 1:79109499-79109521 GTCTAGAGCCTTTGCAAGGATGG - Intergenic
910444239 1:87284398-87284420 ACGTAGAGCCCTGGGAAGGAAGG + Intergenic
910854795 1:91684629-91684651 GTGCAGTGCTTTGGAGAGGAAGG + Intronic
913138636 1:115917463-115917485 GGGTAGGGGCATGGGGAGGAAGG + Intergenic
915323240 1:155067475-155067497 ATGTGGGGCCTTGGGAAGGAGGG + Intronic
915603506 1:156937074-156937096 GTGCTGGGCCTTGGGGAGGAGGG + Intronic
915849850 1:159309776-159309798 GTGAAGAGCACTGGGGAGAAAGG - Intergenic
915892447 1:159784252-159784274 GTGCAGAGATGTGGGGAGGATGG - Intergenic
919675128 1:200374629-200374651 GTGGAGAGAGTTGGAGAGGACGG + Intergenic
919733392 1:200928830-200928852 GTGTAGAGGGGTGGGGAGGTTGG + Intergenic
919757527 1:201075211-201075233 GCCTAGAGCAGTGGGGAGGAAGG - Intronic
920498613 1:206472544-206472566 GTGTAGGGCGTTGGGGAGAAGGG - Intronic
922605511 1:226887544-226887566 TTGTAGACCTTTGGGTAGGAGGG + Intronic
1062837616 10:646305-646327 GTGGAGAGCCTGGGGGAGGCTGG - Intronic
1062898556 10:1124057-1124079 GTGGAGAGGCTTTGGGAGGCGGG + Intronic
1063676172 10:8142185-8142207 GTGTAGGGGCCTGGGGAAGAGGG + Intergenic
1066408654 10:35144242-35144264 GCGTTGAGCCTTAGGGAGAAAGG - Intronic
1068627166 10:59262153-59262175 GTGGAGAGAGTTGGGGAGAAAGG + Intronic
1068731824 10:60366622-60366644 GTGAGGGGGCTTGGGGAGGAAGG + Intronic
1071251479 10:83823968-83823990 CTGGAGAGCCTGGGGAAGGAAGG - Intergenic
1072217058 10:93296338-93296360 GCGTGGAGCCATGGGGAGCAGGG + Intergenic
1072366735 10:94718938-94718960 GTGTAGTGCCTGGGTGAGGTTGG + Intronic
1072791065 10:98318212-98318234 CTGTAGAGCCTTTGGAAGGCGGG + Intergenic
1073073389 10:100808758-100808780 TCGAGGAGCCTTGGGGAGGAGGG - Intronic
1073083266 10:100873096-100873118 GTGCAGAACTTTGGGGAAGATGG - Intergenic
1073124673 10:101141911-101141933 CTGTAGGGGCTGGGGGAGGAGGG - Intergenic
1073288663 10:102402763-102402785 GAGTAAGCCCTTGGGGAGGAAGG + Exonic
1074308283 10:112299032-112299054 GTGCAGAGCCAGGGAGAGGAGGG + Intronic
1074777236 10:116775389-116775411 CTAGAGAGCCCTGGGGAGGACGG + Intergenic
1075073694 10:119336246-119336268 CTGTGGAGCCGTGGGGAGGAAGG - Intronic
1076626567 10:131824675-131824697 GTGAAGACCCCTGAGGAGGAGGG + Intergenic
1077403314 11:2369512-2369534 GTGTGGAGCCCTGGGGAGCAGGG - Intergenic
1077554572 11:3219704-3219726 ATGTGGATCCTGGGGGAGGAGGG - Intergenic
1078140841 11:8691943-8691965 GGGTGGAGAATTGGGGAGGAAGG + Intronic
1078396494 11:10986339-10986361 ATGTAGACCTTTGGGGAGAATGG - Intergenic
1079327684 11:19508318-19508340 CCATAGAGCCCTGGGGAGGAAGG - Intronic
1080729432 11:34934418-34934440 GGGAAGAGCCCGGGGGAGGAAGG + Intronic
1081261878 11:40971420-40971442 GTGTTAGGCCTGGGGGAGGAGGG + Intronic
1081553282 11:44133773-44133795 GGGTAGGGTCTTGGTGAGGAAGG + Intronic
1081684632 11:45033528-45033550 GTGAGGAGTCTTAGGGAGGAAGG + Intergenic
1082630687 11:55538416-55538438 GTGTAGAGCTTTGGGAAAAAGGG - Intergenic
1082814425 11:57498906-57498928 ATCTAGTGACTTGGGGAGGATGG - Intronic
1083279692 11:61619305-61619327 GGGTGGGGCCTTGGGGAGGGAGG - Intergenic
1083427991 11:62599164-62599186 CTGCAGCTCCTTGGGGAGGAAGG - Intronic
1089196810 11:116698345-116698367 GGGTAGAGTCTGGAGGAGGAAGG + Intergenic
1089333506 11:117706650-117706672 GTGTGCAGCATTGGGGAGGAAGG + Intronic
1090231689 11:125111560-125111582 GAGTAGAGCCTGGGGGAGAGTGG - Exonic
1090374974 11:126282319-126282341 GTGAAGCACCTTGGGGAGAAGGG - Intergenic
1091633046 12:2176724-2176746 GTTTAGAGACTCGGGGAGGAAGG - Intronic
1094063653 12:26341108-26341130 TTGCAGAGCTTTGGGGAGGATGG - Intronic
1096059124 12:48681772-48681794 CTGTGGAGACTTGGGGAGGGCGG - Intronic
1096574777 12:52545889-52545911 CTGTAGAGCCCTGGGGAAGCTGG + Intronic
1096648407 12:53050215-53050237 GCTCAGAGCCCTGGGGAGGAGGG + Intronic
1097088722 12:56488348-56488370 GTGAGGAGCGTTGGGGATGAAGG + Exonic
1097168607 12:57099432-57099454 GTGGAGAGCCTATGGTAGGAAGG + Exonic
1100095001 12:91023312-91023334 GTGTAGAGGCTTGGGGTAGTGGG + Intergenic
1100457947 12:94770584-94770606 GTCTAGAGCCTGGGGGAGTGAGG - Intergenic
1101329507 12:103746112-103746134 ATGTAGTGCTTAGGGGAGGAGGG - Intronic
1101950272 12:109169276-109169298 GTGAAGAGCTTGGGGCAGGAAGG - Intronic
1102432986 12:112897980-112898002 GTCAAGGGCATTGGGGAGGAGGG - Exonic
1102574834 12:113849821-113849843 GCGTAGAGGATGGGGGAGGAGGG - Intronic
1104160190 12:126171506-126171528 GTGTTGGGCCAAGGGGAGGAGGG + Intergenic
1110865843 13:80395245-80395267 GTGGAGACACTTGGGGAGGCTGG + Intergenic
1112248258 13:97754171-97754193 GTGGAAAGACTGGGGGAGGAAGG - Intergenic
1112775490 13:102839342-102839364 GTAGAGAGGCATGGGGAGGAAGG + Intronic
1113797457 13:113066729-113066751 TTGGGGAGTCTTGGGGAGGATGG - Intronic
1113908366 13:113830626-113830648 GGATGGAGCCATGGGGAGGAGGG - Intronic
1113908394 13:113830701-113830723 GGATGGAGCCATGGGGAGGAGGG - Intronic
1113908421 13:113830777-113830799 GGATGGAGCCATGGGGAGGAGGG - Intronic
1118594442 14:67424910-67424932 GGGACCAGCCTTGGGGAGGAAGG - Intergenic
1118739271 14:68727088-68727110 GTGTTGAGGGTTGGGGAGGTAGG + Intronic
1121104165 14:91269986-91270008 TTGCAGAGCCTCGGGGAGAACGG + Intergenic
1124089278 15:26582564-26582586 GTGTAGATCCTGGGTGAGGCTGG - Intronic
1124142533 15:27089343-27089365 GTATAGACACTTTGGGAGGAGGG + Intronic
1124693745 15:31846325-31846347 GGGTAGAGGTTTGTGGAGGAAGG + Intronic
1125432243 15:39607184-39607206 GCATGGAGCCTTGGGGAGCAGGG - Intronic
1125533481 15:40428979-40429001 GTTTCCAGCCTTGGGGATGAGGG - Intronic
1125815850 15:42583503-42583525 GTGTTTAGAGTTGGGGAGGAAGG + Intronic
1128217814 15:65946384-65946406 GTGAAGACATTTGGGGAGGATGG + Intronic
1128676235 15:69610999-69611021 ATGAAGAGCCTGGGGGAGGCAGG + Intergenic
1130928558 15:88403608-88403630 GGGTGGAGACTTGGAGAGGAAGG - Intergenic
1131355505 15:91742514-91742536 GGGTAGAGACTAGGGCAGGAAGG - Intergenic
1131675787 15:94668807-94668829 AAGAAGAGCCTTGAGGAGGATGG - Intergenic
1132336923 15:101053598-101053620 AGGCAGAGCCTTGGCGAGGACGG + Intronic
1132988279 16:2779309-2779331 GTGTGGAGCCCTTGGGAGGTTGG + Intergenic
1133221910 16:4322547-4322569 GTGAAGAGCCTTGGGGAGGTGGG - Intronic
1135834096 16:25807300-25807322 GTGGAGAGTGTTGGGGAAGAAGG - Intronic
1136553542 16:30994752-30994774 GTGTGGAGCCTTGGGTAGTGGGG - Intronic
1136924816 16:34362220-34362242 GAGTGGAGCCTTGGGGTGAAGGG - Intergenic
1136979757 16:35049586-35049608 GAGTGGAGCCTTGGGGTGAAGGG + Intergenic
1139227594 16:65248263-65248285 GTGTTAAGACTTGGGTAGGAGGG - Intergenic
1139574289 16:67831516-67831538 GAGGAGAGACTTGGGGAGGGAGG - Intronic
1141410709 16:83830975-83830997 GTGGAATGCCTCGGGGAGGAAGG + Intergenic
1141413424 16:83852045-83852067 CTGTGGTGCCTTGGGCAGGAGGG + Intergenic
1141602013 16:85132732-85132754 GGGCAGAGCCTTGGGGATGCAGG + Intergenic
1141764512 16:86049564-86049586 GTGTTGGGCCAAGGGGAGGATGG - Intergenic
1142779743 17:2172287-2172309 GTGCAGAGCTTTGTGGCGGAGGG + Intronic
1145203810 17:20969708-20969730 GTGCAGGGGCTTGGGGAGGCTGG - Intergenic
1147265466 17:39231845-39231867 GGGTGGAGCCCTGCGGAGGAGGG + Intergenic
1148872811 17:50668682-50668704 GTGGGGAGCCCTGTGGAGGAGGG - Intronic
1151557983 17:74856297-74856319 GTGCAGATCCTGGGGGAGGCGGG - Intronic
1152300245 17:79491202-79491224 GTGCAGAGCCTTGGACAGAAGGG + Intronic
1156239222 18:35235986-35236008 GGCTAGCACCTTGGGGAGGAAGG - Intergenic
1156301582 18:35841067-35841089 GGGTAGGGGCTTGGGGAGCAGGG - Intergenic
1156495274 18:37521335-37521357 GTGTGGGGACTTGGGGTGGAGGG - Intronic
1157134275 18:45038759-45038781 GTTCAGAGTCTAGGGGAGGATGG - Intronic
1157735288 18:50042765-50042787 GTGCAGAGCCCGGGAGAGGAGGG - Intronic
1158699480 18:59733427-59733449 GTGCTGAGGTTTGGGGAGGAAGG + Intergenic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1160023428 18:75199341-75199363 TTGTAAAGACTTGGGGAGTAAGG - Exonic
1160285580 18:77539878-77539900 GCAGGGAGCCTTGGGGAGGATGG - Intergenic
1161983015 19:7639634-7639656 GGTTGGAGGCTTGGGGAGGAGGG - Intronic
1161983826 19:7643630-7643652 GGGCAGAGCCTTGGAGAGGTGGG + Intronic
1161983963 19:7644039-7644061 GGGTGGAGCCTTGGAGAGGTGGG + Intronic
1161983986 19:7644107-7644129 GGGTGGAGCCTTGGAGAGGTGGG + Intronic
1161983997 19:7644141-7644163 GGGTGGAGCCTTGGAGAGGTGGG + Intronic
1162758544 19:12874649-12874671 GGGGAGAGCTTTGGGGAGGCGGG - Exonic
1163078722 19:14919847-14919869 GTGTACAACCTTGGGCTGGAAGG + Intergenic
1163419012 19:17203855-17203877 GTGAGGAGCCTGGGGAAGGAGGG - Intronic
1164684387 19:30157315-30157337 GGGGAGAGCCAGGGGGAGGAAGG + Intergenic
1165047137 19:33114116-33114138 GTGTAGGGTCCTGGGGAGGTAGG - Intronic
1165211147 19:34236816-34236838 GTCTACAGCTTTGGGTAGGAGGG - Intergenic
1165420837 19:35721204-35721226 GTGGAGGGGCTGGGGGAGGAGGG - Exonic
1165796704 19:38523974-38523996 GTGCAGAGGCTGGGGGAAGAGGG - Intronic
1166201156 19:41238634-41238656 GTGGAGTGGCTTGGGGAGGAGGG + Intronic
1166211452 19:41309198-41309220 GGGAAGAGTCTTGAGGAGGATGG - Intronic
1166390463 19:42406427-42406449 GGGCAGAGGCCTGGGGAGGAGGG + Intronic
1166768120 19:45264643-45264665 GTGTAGGGCATTAGGGAGAAAGG - Intronic
1166842914 19:45709875-45709897 GTGTAGTGCTTCTGGGAGGAAGG + Intergenic
1168228198 19:55011512-55011534 GGGTAGAGACATGGAGAGGAGGG + Intergenic
925570312 2:5303453-5303475 GTGTAGAGCTTGGGGAATGATGG + Intergenic
930105787 2:47638329-47638351 GTGTAGAGCAGTGGGGAGGGTGG - Intergenic
933171267 2:79128476-79128498 GAGGAGAGCCTTTGGGAGAAAGG + Intergenic
934557323 2:95294329-95294351 GTTTGGAGGCCTGGGGAGGAGGG + Intergenic
934956872 2:98630473-98630495 GGGTATAGCTTTGGGGAGAAGGG + Intronic
935184619 2:100720949-100720971 GTCAAAAGCCTTGGGAAGGATGG - Intergenic
935233606 2:101119696-101119718 GTCAAGAGCCTTAGGGAAGAGGG - Intronic
936524341 2:113232716-113232738 GTGTAGGGGCTTTGGGAGTAGGG + Intronic
937456036 2:122042558-122042580 GTGTTGTGCCTTGTGGAGCAGGG - Intergenic
938556721 2:132430998-132431020 GTTTAGAGGGGTGGGGAGGAGGG + Intronic
940789153 2:158013474-158013496 GTGGAAAGGCTTGGGGAAGAGGG + Intronic
940816057 2:158298986-158299008 GTGTTGAGCCTTAGTCAGGAAGG + Intronic
941343034 2:164330737-164330759 GTGTACAGCCTGGGGGAGCCAGG - Intergenic
944175765 2:196827476-196827498 GTGTACAGGATTGGGGTGGAGGG - Intergenic
947982813 2:234425161-234425183 GTGTACAGACTTGGGGAGCAGGG - Intergenic
948677574 2:239607794-239607816 GAGATGGGCCTTGGGGAGGAAGG + Intergenic
1172485307 20:35294324-35294346 GTGAAGGGCCTGGGGGAGCATGG + Intergenic
1174365323 20:50053162-50053184 GTGTGGGGCTTTGGGGAGGGGGG + Intergenic
1178300114 21:31445791-31445813 GAGTACAGCCAGGGGGAGGAGGG + Intronic
1178493730 21:33070434-33070456 GCGCGCAGCCTTGGGGAGGAGGG - Exonic
1179022967 21:37656560-37656582 CTGCAGAGCCATGGGGAGGCTGG - Intronic
1179978000 21:44881616-44881638 GTGTGGAGCCTTGGACAGGCAGG + Intergenic
1181048536 22:20227914-20227936 TTGTGGGGTCTTGGGGAGGAGGG + Intergenic
1183164918 22:36140393-36140415 GTTTAGAGACTGGGGGAGGCCGG - Exonic
1184226806 22:43133478-43133500 CCGTAGAGCCTGGGGAAGGAAGG + Exonic
1184982079 22:48101984-48102006 GGGCAGAGCCCTGGGCAGGACGG - Intergenic
949433721 3:4005835-4005857 TTGTAGAGCCTGTGGGAGGTGGG - Intronic
950536886 3:13583915-13583937 GTGAAGACCCTTAGGGATGAGGG + Intronic
950706416 3:14785244-14785266 GGGTACAGCCTTGGGCAGGGAGG + Intergenic
950967136 3:17154354-17154376 GTGTGCAGCCTTGGGCAGGAGGG + Intergenic
951758475 3:26118283-26118305 GGGTAGAGGGTTGGAGAGGAAGG - Intergenic
954083277 3:48224775-48224797 GGGAAGAGCCCTGGGTAGGAGGG - Intronic
954459064 3:50616261-50616283 GTCTAGAGCCATAGGGAGGGTGG - Intronic
954649409 3:52151124-52151146 GTGTGAAGCCTGGGTGAGGAAGG + Intronic
955053181 3:55431943-55431965 GGGAAGATCCTGGGGGAGGAGGG + Intergenic
957146761 3:76434711-76434733 TGGTAGAGACTGGGGGAGGAGGG - Intronic
961107930 3:124258069-124258091 GAGAACAGCCTTGGGGAAGAGGG + Intronic
962522226 3:136208055-136208077 GTGCAGAGCCCAGGTGAGGAAGG - Intergenic
963209430 3:142672928-142672950 TTGCAGAGCCTTCGGGAAGAGGG - Intronic
967157534 3:186707362-186707384 GTGTTCAGCCTTGGGGAGTAAGG + Intergenic
967368613 3:188717092-188717114 GTGGAGAGCCCTGGGGAGTGGGG - Intronic
969931363 4:10634206-10634228 GAGTAGAGCCTAGGGGAGGAAGG + Intronic
970073721 4:12194507-12194529 GGGTAGAGCCTGTGGGAGGTGGG - Intergenic
971380682 4:26094550-26094572 ATGTTGACCCTTGGGAAGGAGGG - Intergenic
971457773 4:26860676-26860698 GTGGAGAGCCTGAGGGAGGCGGG + Intronic
971689075 4:29809940-29809962 GTGTAGAGCCAACTGGAGGAAGG - Intergenic
972276840 4:37565507-37565529 TGGAAGAGCCTGGGGGAGGAAGG - Intronic
976280111 4:83318920-83318942 GTTTAGAGCATTAGGCAGGAGGG - Intronic
980980056 4:139647140-139647162 GAGAACAGCCTGGGGGAGGAAGG - Intergenic
981336854 4:143578059-143578081 GTGTAAAGCCCTGGTGAGGATGG - Intronic
981786107 4:148481421-148481443 GTGTGGAAGCTTGGGGAGTAGGG - Intergenic
983883925 4:172960921-172960943 GAGTAGAGACTTGGAGAGAAAGG + Intronic
983883975 4:172961095-172961117 GGGTAGAGACATGGGGAGAAGGG + Intronic
984236010 4:177159808-177159830 ATGTTGAGCCTTGGGGGGGCGGG - Intergenic
984965693 4:185137802-185137824 GTGTGGATCCCTGGGAAGGAGGG - Intergenic
987331345 5:16860241-16860263 GTGTAGGGGCTATGGGAGGAGGG - Intronic
989210434 5:38853926-38853948 CTGTGGAGCCTTGAGGAGGAAGG + Intronic
989708939 5:44372936-44372958 GTGCAGAGCCTTGGGTACAAAGG - Intronic
990948740 5:61275958-61275980 GTGTAAAGCCCTGAGGTGGAGGG - Intergenic
991943282 5:71875798-71875820 AAGTAGGGCCTTTGGGAGGAGGG + Intergenic
992388750 5:76311322-76311344 ATTAAGAGCCTTGGGGAGAAGGG - Intronic
993660768 5:90631490-90631512 GTGTAGGGCTCTGGGGAAGATGG - Intronic
995175916 5:109176480-109176502 GGGTAGAGAGGTGGGGAGGATGG + Intronic
997422231 5:133778826-133778848 GGGAAGAGCCCTGGGCAGGACGG - Intergenic
998298983 5:141000110-141000132 TTGTGAAGCCTTGGGGATGAGGG - Intronic
1000026449 5:157363140-157363162 CTGGAGTGCCTTGGGGAGGAAGG - Intronic
1000111649 5:158113781-158113803 GAGTAGGGCTTTGGGGAAGAAGG - Intergenic
1000986519 5:167866609-167866631 GTTTAGAGCATAGGGAAGGAGGG + Intronic
1001637658 5:173223670-173223692 GTGTGGTGTCTTGGGGAGTATGG + Intergenic
1002093334 5:176817326-176817348 CTGAAGCGCCTTGGGGAGGGAGG + Intronic
1002868763 6:1147256-1147278 GTGTGGAGCCCTGGCGGGGATGG - Intergenic
1003544791 6:7051002-7051024 ATGAAGAGCTCTGGGGAGGAAGG + Intergenic
1004926257 6:20417976-20417998 TTATAGAGGCTGGGGGAGGAAGG + Intronic
1005914347 6:30339817-30339839 CTGTGGAACTTTGGGGAGGAGGG + Intronic
1005994834 6:30924666-30924688 CTGTGGAGCCCTGGGGAAGATGG + Intronic
1006412481 6:33882463-33882485 TTGCAGAACTTTGGGGAGGAGGG + Intergenic
1006445390 6:34076963-34076985 CAGGAGAGCCTTGGGGAGCAAGG + Intronic
1006881573 6:37344493-37344515 GTGGAGAGGCTTGGGGAGTGGGG - Intergenic
1007096001 6:39213605-39213627 GTGCAGAGCAGTGGGGAAGAGGG + Intronic
1007865944 6:44971020-44971042 CTGTGTATCCTTGGGGAGGATGG - Intronic
1008370022 6:50721380-50721402 TAGTTGAGCCTTGGAGAGGAGGG + Intronic
1010514848 6:76760722-76760744 ATGTAGAGATTTGGGGAGGGTGG - Intergenic
1015355812 6:132275722-132275744 GACTAGAGCCCTGGAGAGGAAGG - Intergenic
1015614978 6:135065133-135065155 GTGTTGAGAGTTGGGCAGGAGGG - Intronic
1015735291 6:136393161-136393183 TTGGAGAGCAGTGGGGAGGAAGG - Intronic
1016396076 6:143624755-143624777 GTGTAAAGGCTTGGCCAGGATGG + Intronic
1017602004 6:156093465-156093487 GAATAGAGCTTTGGGGAGCAAGG + Intergenic
1019411431 7:908452-908474 TTGTAGAGGCTTGGGGAGCGGGG - Intronic
1019450479 7:1095215-1095237 GAGTACATCCCTGGGGAGGAGGG - Intronic
1019716232 7:2540746-2540768 GTGTGGGGCCGTGGGGAGCAGGG - Intronic
1020415945 7:7945913-7945935 CTGTACAGCCTTGGGAAGGGTGG - Intronic
1020423051 7:8031408-8031430 GTGGGGAGCCATGGGGAGGTGGG + Intronic
1023046639 7:36215696-36215718 GGTTAGATCCTTGGGGAGTAAGG + Intronic
1023203741 7:37725553-37725575 GAGCTGAGCCTTGGGGATGAGGG - Intronic
1024546725 7:50528654-50528676 CTGTGGAGCCTTGGGGAGCTTGG + Intronic
1024934381 7:54698111-54698133 CTGCAGAGGCTTGGGGTGGACGG + Intergenic
1025108576 7:56193696-56193718 GTGGAGACCCATGGGGAGGGAGG + Intergenic
1027442137 7:78230938-78230960 CTCAAGAGCCTTGGGGAGGATGG + Intronic
1029663816 7:101981193-101981215 GTGTATAGGTTGGGGGAGGAGGG - Intronic
1029704040 7:102266412-102266434 GAGTACAGACTTGGGGAGGAAGG + Intronic
1032784314 7:135188437-135188459 GTGTACAGCATCGGCGAGGACGG - Exonic
1033869298 7:145730688-145730710 ATGTTGAGCCCTGGGGAGCAAGG + Intergenic
1034456877 7:151175435-151175457 GTGCAGAGAGTTGGGCAGGAAGG - Intergenic
1035430342 7:158815431-158815453 GGGAATAGCTTTGGGGAGGAAGG - Intronic
1035886571 8:3297723-3297745 TTGTATAGCTTTGGGGAGGGAGG + Intronic
1037529538 8:19759108-19759130 GTGGACAGGCTTGGGGAGGGTGG + Intergenic
1038044553 8:23755113-23755135 GTTTAGAGAGTTGGGGAGAAAGG - Intergenic
1041260673 8:56018587-56018609 GTGAAGAGCCTGGGAGAAGACGG + Intergenic
1044516489 8:93144733-93144755 GAGTAGAGGCTTGGGGATGGTGG + Intronic
1045007556 8:97929413-97929435 GAGTAGAGAATGGGGGAGGAGGG + Intronic
1045704308 8:104902976-104902998 GTGTAGAGTTTTGGAGGGGATGG + Intronic
1048974253 8:139662260-139662282 TTGCAGAGCCCTGGGCAGGAAGG - Intronic
1049555180 8:143278060-143278082 GTGCAGCCCCTTGGGGAAGACGG + Intergenic
1049603109 8:143517261-143517283 GGGTAGAGCCGTGGGGAAGAGGG - Intronic
1050033913 9:1414908-1414930 GTGGAAAGCCCTGGGGAGAATGG + Intergenic
1053142733 9:35691137-35691159 GTGGAGAGCCGCCGGGAGGAGGG + Intergenic
1056710706 9:88990543-88990565 CTGTAGAAGCTTGGGGAGAAAGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057714821 9:97484272-97484294 CTGCAGGGCTTTGGGGAGGAGGG - Intronic
1058178479 9:101767017-101767039 GTGTAGAGCCATGGTTATGAGGG + Intergenic
1058526738 9:105866546-105866568 GTCTAAAGTCTTGGGCAGGAGGG + Intergenic
1059440783 9:114305686-114305708 GTGTAGAGAATTGTGCAGGAGGG + Intronic
1060214328 9:121729523-121729545 GAGTCCAGCCTTGAGGAGGAGGG + Intronic
1060403043 9:123359260-123359282 GGGTAGAGCCTTGGGGCCCAGGG + Intronic
1061050125 9:128190494-128190516 GTGAGAAGCCTTGGGGAAGAAGG - Intronic
1061283236 9:129609250-129609272 GTGCAGAGGCGTGGGGAGGTGGG + Intronic
1061659580 9:132119993-132120015 GTGTAGAGTCATGGGGAGGAGGG - Intergenic
1061770954 9:132920897-132920919 CTGTAGGGCCCTGGGGAGGATGG + Intronic
1062287447 9:135779345-135779367 GGGAAGAGCCTGGGGGAGGCAGG - Exonic
1203381265 Un_KI270435v1:47198-47220 TTGGAGAGCCTTGGGGATTATGG + Intergenic
1195810987 X:108829455-108829477 GTAAAGAGGCTTGGGGAGGTAGG - Intergenic
1198786750 X:140297145-140297167 GGCTAGAGCTCTGGGGAGGATGG - Intergenic
1199086621 X:143635582-143635604 CTGGAGAGCCTGGGGGAGGGGGG + Intronic
1201240482 Y:11953537-11953559 GTGGAGAGCCTTCGAGGGGAAGG - Intergenic