ID: 903723646

View in Genome Browser
Species Human (GRCh38)
Location 1:25424673-25424695
Sequence CAATCAGAGGCCAGGCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7864
Summary {0: 3, 1: 22, 2: 178, 3: 1325, 4: 6336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903723646_903723655 28 Left 903723646 1:25424673-25424695 CCACTGTGCCTGGCCTCTGATTG 0: 3
1: 22
2: 178
3: 1325
4: 6336
Right 903723655 1:25424724-25424746 CCTTTCTGCTCCCCTTGACAAGG 0: 1
1: 1
2: 2
3: 27
4: 200
903723646_903723656 29 Left 903723646 1:25424673-25424695 CCACTGTGCCTGGCCTCTGATTG 0: 3
1: 22
2: 178
3: 1325
4: 6336
Right 903723656 1:25424725-25424747 CTTTCTGCTCCCCTTGACAAGGG 0: 1
1: 1
2: 0
3: 14
4: 198
903723646_903723649 -9 Left 903723646 1:25424673-25424695 CCACTGTGCCTGGCCTCTGATTG 0: 3
1: 22
2: 178
3: 1325
4: 6336
Right 903723649 1:25424687-25424709 CTCTGATTGCCCTATTTAAAAGG 0: 1
1: 1
2: 0
3: 17
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903723646 Original CRISPR CAATCAGAGGCCAGGCACAG TGG (reversed) Intronic
Too many off-targets to display for this crispr