ID: 903725063

View in Genome Browser
Species Human (GRCh38)
Location 1:25435648-25435670
Sequence AGATTGCAACACAGGTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903725063_903725068 7 Left 903725063 1:25435648-25435670 CCCAGATACCTGTGTTGCAATCT 0: 1
1: 0
2: 0
3: 32
4: 218
Right 903725068 1:25435678-25435700 TAAAAGCATTTTGGTAATCTTGG 0: 1
1: 0
2: 2
3: 23
4: 284
903725063_903725069 11 Left 903725063 1:25435648-25435670 CCCAGATACCTGTGTTGCAATCT 0: 1
1: 0
2: 0
3: 32
4: 218
Right 903725069 1:25435682-25435704 AGCATTTTGGTAATCTTGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 204
903725063_903725066 -2 Left 903725063 1:25435648-25435670 CCCAGATACCTGTGTTGCAATCT 0: 1
1: 0
2: 0
3: 32
4: 218
Right 903725066 1:25435669-25435691 CTCATAGCCTAAAAGCATTTTGG 0: 1
1: 0
2: 2
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903725063 Original CRISPR AGATTGCAACACAGGTATCT GGG (reversed) Intronic
901038095 1:6348450-6348472 GGATTTCAACACAGGGATTTTGG - Intronic
901757030 1:11447680-11447702 ATATTTCAAAACAGGTATGTGGG + Intergenic
903386881 1:22932877-22932899 GGATCCCAACACAGGTCTCTAGG - Intergenic
903725063 1:25435648-25435670 AGATTGCAACACAGGTATCTGGG - Intronic
904825520 1:33271526-33271548 AGATTGGAACCCGGGTATGTTGG + Intronic
907291364 1:53414984-53415006 GGAATGCAACACAGGGGTCTTGG + Intergenic
907331896 1:53676983-53677005 AGAATGTAACACAGGTCTCTGGG + Intronic
907586595 1:55623382-55623404 AGATTTCAACATAGGAATTTAGG + Intergenic
907656682 1:56350152-56350174 AGATTTCAACACATGAATTTGGG + Intergenic
908650043 1:66322720-66322742 AGGTTTCAACACAGGAATTTTGG + Intronic
909858462 1:80572439-80572461 GGATTGCAACACATGAATTTTGG + Intergenic
909930683 1:81495699-81495721 AAATTTCAACTCAGGTAACTAGG + Intronic
911643824 1:100317711-100317733 AGGTTCCAACACAGGAATTTGGG - Intergenic
911787006 1:101963480-101963502 AGGTAGCACCACAGGCATCTGGG + Intronic
913065087 1:115243874-115243896 AGCTTACCTCACAGGTATCTGGG + Intergenic
913202937 1:116510851-116510873 AGATGTCAACACAGGTGGCTTGG + Intergenic
915966054 1:160309219-160309241 AAATTGGAAAACTGGTATCTTGG - Intronic
917178468 1:172265490-172265512 AGATGGCATCATAGATATCTGGG + Intronic
917605359 1:176623088-176623110 AGATTTCAACACAGGAAATTTGG + Intronic
919407817 1:197206845-197206867 AGATGGCAACACAGTAATATTGG - Intergenic
919567542 1:199207550-199207572 AGATTTCAAGATAGGTATCTTGG - Intergenic
919692421 1:200539965-200539987 AGATTACAACTCAGGTTTGTTGG - Intergenic
922451022 1:225737422-225737444 AATTTGCAACACTGGCATCTTGG - Intergenic
924335229 1:242980832-242980854 AGATTGCAACCCAGATATCCTGG - Intergenic
1063388753 10:5634665-5634687 GGATTTGAACACAGGAATCTGGG + Intergenic
1066668632 10:37813063-37813085 AGATTTCAATACATGGATCTTGG + Intronic
1067103971 10:43352814-43352836 AGATTGCACCACTGCAATCTCGG - Intergenic
1067782055 10:49214910-49214932 AGATTTCAACATATGCATCTTGG + Intergenic
1069980222 10:72247397-72247419 AGATCGGAACACAGGTCTTTTGG + Intergenic
1070576455 10:77682515-77682537 AGATTCCCACACAGTTACCTAGG + Intergenic
1072217330 10:93298329-93298351 AGATTTCAACACAGGAATTTGGG + Intergenic
1075151163 10:119933465-119933487 GAATTGCAACACAGCTATTTTGG + Intronic
1075395900 10:122126882-122126904 GGATTTCAACACAGGAATTTCGG - Intronic
1075948620 10:126458677-126458699 AGATTGCAAAACAGATCTCGGGG - Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080081834 11:28229471-28229493 AGGTTTCAACACAGGAATTTAGG - Intronic
1080594310 11:33756468-33756490 ATATAGCAATACAGGTATCAAGG + Intronic
1081368602 11:42268668-42268690 AGATTCAAACACAGGTATGCAGG + Intergenic
1081368724 11:42271520-42271542 AGATTCAAACACAGGTATGCAGG + Intergenic
1081397465 11:42603602-42603624 AGTTTTCAACACAGGAAGCTTGG + Intergenic
1081429999 11:42966526-42966548 AATTTGCAACACAGGTAAGTAGG + Intergenic
1082120659 11:48376362-48376384 AGATGGCAACACAATTATATTGG - Intergenic
1083887391 11:65579490-65579512 CAATTGCAACACAGGTCTCCTGG + Intronic
1086236156 11:84633416-84633438 CTACTGCAACACAGGTTTCTGGG + Intronic
1086263897 11:84974805-84974827 AGCATGCATCACAGTTATCTGGG - Intronic
1088713409 11:112528046-112528068 AGATCTCAACACAGGAATTTTGG - Intergenic
1089038756 11:115425624-115425646 AGATTGCAACATAGGTTTGTGGG + Intronic
1091323379 11:134667039-134667061 ACATTTCAACACAGGAATCTGGG - Intergenic
1091629904 12:2152114-2152136 CCATTGCAACGCAGCTATCTAGG - Intronic
1091862540 12:3799105-3799127 AGATTTCAACATAGGAATTTGGG - Intronic
1097558441 12:61170003-61170025 AGATTCGAACACAGGCATCCGGG - Intergenic
1098439113 12:70499504-70499526 AGATTCCAAGAGAGGTTTCTTGG + Intergenic
1098600920 12:72330880-72330902 TTGTTGCAACACAGGTATCTGGG + Intronic
1099143114 12:79005366-79005388 AGATTGCAATCCAGGTTTGTGGG - Intronic
1099224403 12:79952135-79952157 ACATTTCAACACAGGAATTTTGG - Intergenic
1099232504 12:80043466-80043488 AGATTTCAACACAAGAATTTTGG + Intergenic
1099652304 12:85443631-85443653 AGTTTAGCACACAGGTATCTAGG + Intergenic
1099753856 12:86814640-86814662 AGATTTCAACACATGAATTTCGG - Intronic
1100765735 12:97863467-97863489 AGATTTCAACACATGAATTTGGG - Intergenic
1101332802 12:103770785-103770807 AGATTTCAACACAGGAATTTTGG - Intronic
1101539522 12:105652418-105652440 GAACTACAACACAGGTATCTGGG + Intergenic
1102613094 12:114129811-114129833 AAATCGTAACACAGGAATCTGGG + Intergenic
1104637011 12:130444097-130444119 AGATTTCAACACAGGTTTTCTGG + Intronic
1105857632 13:24386682-24386704 AGATTTCAACACAGGAATTCTGG - Intergenic
1105968895 13:25409446-25409468 ACATGGCAAAACAGGTAACTTGG + Intronic
1106051818 13:26197622-26197644 TGATTCCTACACAGGTAACTGGG - Intronic
1109173979 13:59132555-59132577 AGATTGCAGCACAGGGCTGTTGG - Intergenic
1112881712 13:104114892-104114914 AGATTGAAACACAGGGTTGTGGG + Intergenic
1114684092 14:24511854-24511876 AGACTGCAACAAAAGTTTCTAGG - Intergenic
1114836569 14:26210203-26210225 AGGTTCCAACACAGGAATTTTGG - Intergenic
1117678441 14:58178897-58178919 AGATTTCAACACATGAATTTTGG + Intronic
1120095636 14:80384573-80384595 GGATTTCAACACACGAATCTTGG + Intronic
1120415894 14:84217492-84217514 AGATTTCAACATAGGAATTTGGG - Intergenic
1121183900 14:91949950-91949972 AGATTTCAACATATGAATCTGGG + Intergenic
1122223418 14:100257458-100257480 AGATTTCAACACATGAATCTGGG - Intronic
1124570466 15:30858272-30858294 GGATTGCAACACATGAATTTTGG + Intergenic
1124712341 15:32025143-32025165 AGTCTTCAACACAGGTATTTTGG - Intergenic
1124792883 15:32746577-32746599 TGATTGCAAGACAGGTTTCAGGG - Intergenic
1125802881 15:42465800-42465822 AGATTGCAACAAAGGTGAGTTGG - Intronic
1128282595 15:66408762-66408784 AGATTTCAACATACGTATATTGG - Intronic
1130761508 15:86825423-86825445 AGGTTGCAAGCCAGATATCTGGG + Intronic
1131571140 15:93537648-93537670 ATACTGCAATACAGGTATATTGG - Intergenic
1135384261 16:22022361-22022383 AGATAGCAATCCAGGTATCAGGG - Intronic
1135741452 16:24978756-24978778 AGATTCGAACCCAGGTAGCTGGG + Intronic
1135936350 16:26783689-26783711 AGTTTCCAACACAGGAGTCTTGG + Intergenic
1137703128 16:50512522-50512544 AGTTTACAACACATGTTTCTGGG - Intergenic
1137765208 16:50972846-50972868 GGATTGAAACACAGGTCTCTGGG + Intergenic
1140521886 16:75588777-75588799 CGATTTCAACATAGGAATCTGGG + Intergenic
1141921510 16:87138701-87138723 AGTTTCCAACACAGGAATCTAGG + Intronic
1146666076 17:34704665-34704687 AGATTCCAACACATGAATTTTGG - Intergenic
1146782104 17:35683459-35683481 ACATTGGACCACAGGTAGCTAGG + Intronic
1149436782 17:56639966-56639988 AGATGGGGACACAGGTATGTTGG - Intergenic
1149852729 17:60050062-60050084 AGATTTCAACATAGGAATTTTGG - Intronic
1151004644 17:70420268-70420290 AGACTGAAACACACGAATCTGGG - Intergenic
1153791112 18:8580637-8580659 AGCTTGCAACACAAGCAACTGGG - Intergenic
1156253306 18:35372931-35372953 AGATTGCTACACAGCTATTCTGG + Intronic
1157702264 18:49769284-49769306 AGGTGGCCACACAGGTGTCTGGG - Intergenic
1160609937 18:80077041-80077063 ACATTTCAACACATGAATCTGGG + Intronic
1165254001 19:34562086-34562108 AGATTTCAACACAGGAATTTTGG + Intergenic
925677046 2:6373800-6373822 AGATTGCAACGTATGTATTTGGG - Intergenic
932521080 2:72413306-72413328 TTATTACAACACAGGTTTCTAGG + Intronic
935607378 2:104984572-104984594 GGATTTCAACACAGGAATTTTGG - Intergenic
936658079 2:114511127-114511149 AGATATCAACATAGGTATATAGG + Intronic
936691036 2:114888909-114888931 AGATTTCAACACACGAATTTGGG - Intronic
937374105 2:121323546-121323568 GGATTTCAACACAGGAATTTTGG - Intergenic
938055923 2:128214589-128214611 AGAATGCATGGCAGGTATCTTGG + Intergenic
938162923 2:129002754-129002776 GGATTTCAACAAAGGAATCTTGG - Intergenic
940116284 2:150212284-150212306 AGATTTCAACATATGAATCTGGG - Intergenic
941434887 2:165457512-165457534 AGATTGCAACACTGCACTCTAGG + Intergenic
941626345 2:167834799-167834821 AGATTGCAACACTGCACTCTAGG + Intergenic
943760871 2:191607229-191607251 AGATTGCAATACATATATCCTGG + Intergenic
944171325 2:196782078-196782100 AGGTATCAACACAGGTATTTTGG - Intronic
944670820 2:201993092-201993114 GGATTTCAACACAGGAATTTGGG - Intergenic
946151307 2:217773336-217773358 AGATTGCAACCTAGGTATATTGG + Intergenic
946952754 2:224895106-224895128 AGCTGCCAACACAGGCATCTTGG - Intronic
946995808 2:225389717-225389739 AGACAGACACACAGGTATCTGGG + Intergenic
948052201 2:234987180-234987202 TGATTACAACACAGGTTGCTGGG - Intronic
1175720217 20:61281223-61281245 GGATTTCAACACAGGAATCTGGG - Intronic
1177921533 21:27158400-27158422 AGATTTTAACACAGGAATTTTGG + Intergenic
1178047528 21:28712049-28712071 ACATTTCAACACAGGAATATTGG + Intergenic
1179477760 21:41658822-41658844 AGATTTCAACACAGGGATTTTGG + Intergenic
1182109304 22:27711480-27711502 AGATTGGAACACAGGTCACTGGG + Intergenic
1182951159 22:34377167-34377189 AGATTTCAACATAGGAATTTTGG + Intergenic
1183204735 22:36410885-36410907 AGGTTGGAACACAAGTAACTGGG - Intergenic
1185073294 22:48668955-48668977 GGATTTCAACACATGAATCTGGG - Intronic
1185354932 22:50362603-50362625 GGATTTCAACATAGGAATCTGGG - Intronic
949500687 3:4677484-4677506 AGATAGCCACACAGATATCTTGG + Intronic
949743281 3:7261190-7261212 AGACTGCAACATAGTTACCTAGG + Intronic
950986317 3:17372077-17372099 AAATTGCACCACAGATATATGGG - Exonic
951319844 3:21231206-21231228 AGATTGCAACATAGGAATTTGGG - Intergenic
952659810 3:35831926-35831948 AGATTGCAAGACAGGCTTCAAGG - Intergenic
953624023 3:44555766-44555788 AGATTGAGACACAGGGATCTGGG + Intronic
954643361 3:52115544-52115566 GGATTTCAACACAGGAATTTTGG - Intronic
955043648 3:55339558-55339580 AGATTGCAATGCAGATAGCTGGG - Intergenic
955810824 3:62786895-62786917 GAATTGAAACACAGATATCTTGG + Intronic
956382270 3:68677044-68677066 ATATAGCAACACAGGCATCTGGG - Intergenic
956679760 3:71767686-71767708 ACATGGCAAAACAGGTAGCTGGG - Intergenic
957393521 3:79610837-79610859 GAATTGTAACACAGGTATCATGG + Intronic
957472749 3:80680250-80680272 AGATTACAACATACGTATTTTGG + Intergenic
957766926 3:84637457-84637479 AGATTGCAACACCCTTCTCTTGG - Intergenic
957868455 3:86055736-86055758 AGATTTCAACACATGAATTTTGG + Intronic
958897410 3:99844305-99844327 GGATTCTCACACAGGTATCTTGG + Intronic
959356304 3:105333960-105333982 AGATTGGAACAGAGGGAGCTAGG + Intergenic
960316306 3:116181916-116181938 AGACTGAAACACAGTTACCTGGG - Intronic
960706195 3:120483870-120483892 AATGTGCAACACTGGTATCTTGG + Intergenic
961176021 3:124835547-124835569 AGATCGCACCACAGGTTTCCGGG - Intronic
962020822 3:131499957-131499979 AGATTGCAACTCAGGTATTCTGG + Intronic
963892353 3:150650066-150650088 AGATTTCAACATAGGAATTTGGG - Intergenic
964716215 3:159725163-159725185 AGATGGAAACAGAGGTATCTTGG - Intronic
965467592 3:169050730-169050752 AGATTGCATCACATGCTTCTTGG - Intergenic
967767686 3:193299616-193299638 AGTTTACAACATAGGTCTCTTGG + Intronic
967846765 3:194049902-194049924 AGACTGGCACTCAGGTATCTTGG - Intergenic
970324153 4:14905661-14905683 AGATTGAAACTCTGGTTTCTAGG + Intergenic
970970115 4:21972984-21973006 AGATTTGAACACAGGTAACCTGG + Intergenic
971386941 4:26149480-26149502 AGTTTGCAACACATGAATTTTGG - Intergenic
972102409 4:35438140-35438162 AGATTCCAACAAATGTATTTTGG + Intergenic
972342853 4:38167564-38167586 GGATTCCAACACATGAATCTGGG + Intergenic
974637425 4:64582798-64582820 GGATTTCAACACAGGGATTTTGG + Intergenic
974660356 4:64880659-64880681 AGATTGCAACATACGAATTTCGG - Intergenic
974791123 4:66691396-66691418 AGTTTGCAACACATGAATTTTGG + Intergenic
976278685 4:83304988-83305010 AGGTGGCAAGGCAGGTATCTTGG - Intronic
977127642 4:93189497-93189519 AGGTTTCAACACAGGAATTTTGG + Intronic
977745841 4:100546158-100546180 AGATTCCAACTCAGGAATCTGGG - Intronic
979018572 4:115466391-115466413 AGATTTCAACACATGAATTTGGG - Intergenic
979090232 4:116473986-116474008 ACAATTCAACACAGGTGTCTGGG - Intergenic
979241883 4:118454448-118454470 AGATTGCAACCCAAATATCCTGG + Intergenic
982069352 4:151681969-151681991 GGATTTCAACACAGGAATTTGGG + Intronic
982126009 4:152184565-152184587 GGATTCCAACACAGGAATTTGGG - Intergenic
984363279 4:178765514-178765536 AGATTTCAACATATGAATCTGGG + Intergenic
986369682 5:7067830-7067852 AATTTGAAACACAGGTTTCTAGG + Intergenic
987559175 5:19496400-19496422 AGATTCCAACACATGAATTTGGG - Intronic
988931385 5:36038932-36038954 AGCTTGGCACACAGGTATGTTGG + Intronic
990143123 5:52728789-52728811 AGATTGAAACGCAGGTGTCCTGG - Intergenic
990815270 5:59777610-59777632 AGATTGCTCCATATGTATCTTGG + Intronic
990892896 5:60666597-60666619 AGATCACATCACAGGAATCTTGG - Intronic
991986831 5:72296997-72297019 AGATTCAAACCCAGATATCTAGG - Intronic
993072969 5:83188894-83188916 AGATCTCATCACAGGTCTCTAGG - Intronic
994654299 5:102570660-102570682 ATATTGCACCTCAGGTAGCTAGG + Intergenic
996020730 5:118588197-118588219 ATATTGCTACATAGGTTTCTAGG - Intergenic
997043742 5:130288641-130288663 GGATTGGAACACAGGTATTCTGG - Intergenic
997342528 5:133156026-133156048 AGAATGTAACACAGGTATTGAGG - Intergenic
998741705 5:145210473-145210495 AAATTGCATCACAGGACTCTTGG + Intergenic
1000405856 5:160887752-160887774 AAAAAGCCACACAGGTATCTTGG - Intergenic
1001741063 5:174053079-174053101 AGATTTGAACCCAGGTCTCTAGG - Intronic
1003735975 6:8877979-8878001 GGATTTCAACACAGGAATTTAGG + Intergenic
1006626380 6:35401015-35401037 ACATACAAACACAGGTATCTGGG - Intronic
1007508982 6:42361032-42361054 GGATTCCAACACATGAATCTGGG - Intronic
1008057796 6:46963171-46963193 TGAGTGCACCACAGGTATCATGG - Intergenic
1008644061 6:53495427-53495449 AGGCTTCAACACAGGGATCTGGG - Intergenic
1008689215 6:53958805-53958827 AGATTTCAACATAGGAATTTCGG + Intronic
1008722168 6:54368036-54368058 AGATTTCAACATAGGAATTTTGG + Intronic
1008911275 6:56736204-56736226 ACAGTTCAACACAGGAATCTAGG - Intronic
1009297061 6:61964824-61964846 AGATTTCCACACAGGTGTTTAGG + Intronic
1009385587 6:63081556-63081578 ACATTGCAGCATAGGTATATAGG + Intergenic
1011420999 6:87172857-87172879 AGATTGCACCACTGCAATCTGGG + Intronic
1011602783 6:89075366-89075388 AGGTTTCAACATAGGAATCTGGG + Intergenic
1012858345 6:104528940-104528962 CAGTTGAAACACAGGTATCTGGG + Intergenic
1013693314 6:112670459-112670481 AGGTTGCAACATATGTATTTTGG + Intergenic
1016734309 6:147459968-147459990 AGATTTCAACACATGAATCTTGG - Intergenic
1017230667 6:152069836-152069858 AGTTTGCAACCCAGGCAGCTGGG + Intronic
1018133488 6:160754902-160754924 AGATTGAATCACAGGTTCCTGGG - Intergenic
1018975651 6:168563537-168563559 GGATTTCAACACAGGAATTTGGG - Intronic
1021072897 7:16264876-16264898 AGATTCAAACCCAGGGATCTTGG - Intronic
1021225476 7:18021295-18021317 GGATTTCAACACAGGAATTTTGG - Intergenic
1021412777 7:20346914-20346936 AGATTTCAACACATGAATTTTGG - Intronic
1023539272 7:41248169-41248191 AGAAAGTAAGACAGGTATCTTGG + Intergenic
1023810506 7:43907605-43907627 AGATTCCAACACAGGTATTCTGG - Intronic
1024250740 7:47504010-47504032 AGGTTTCAACACAGGAATCTGGG + Intronic
1029347414 7:99988499-99988521 AGATTGCAACACTGCAATCCAGG - Intergenic
1031901887 7:127419807-127419829 AGATTTCAACATATGAATCTGGG - Intronic
1034579587 7:152031030-152031052 ATATTGCAGCACAGGCATGTAGG + Intronic
1034675802 7:152891721-152891743 AGGATGCAACACATGGATCTGGG - Intergenic
1034888961 7:154822496-154822518 GGATTTCAACAGAGGAATCTAGG + Intronic
1035925063 8:3719301-3719323 AGATTGGAGCTCAGCTATCTGGG - Intronic
1038320432 8:26521016-26521038 GGATTTCAACACAGGAATTTTGG + Intronic
1039101465 8:33946487-33946509 GGAGTTCAACACAGGTATCATGG + Intergenic
1039951621 8:42177387-42177409 AGATTGTATCTCAGTTATCTTGG + Intronic
1040433976 8:47371631-47371653 AGATTTCAACATAGGAATCTTGG + Intronic
1040727309 8:50397803-50397825 AGAATTCAACACAGGCAGCTAGG - Intronic
1040825180 8:51612530-51612552 GGATTTCAACACAGGTATTTGGG - Intronic
1041040943 8:53845166-53845188 GGATTTCAACACAGGAATTTTGG + Intergenic
1042935197 8:74051566-74051588 GGATTGCAACACAGGAATTTTGG - Intergenic
1045736314 8:105299656-105299678 AGATTTCAACACAGGAATTTGGG + Intronic
1046377978 8:113411933-113411955 AGATTTCAACTCACGTATTTTGG - Intronic
1046423926 8:114021029-114021051 AGATTGCAACATAGGGATTGAGG - Intergenic
1047148875 8:122238105-122238127 GGATTTCAACATAGGAATCTGGG + Intergenic
1047851278 8:128860127-128860149 GGATTTCAACACAGGAATTTGGG + Intergenic
1048544344 8:135372499-135372521 GGATTTCAACACAGGAATTTTGG - Intergenic
1050729011 9:8686302-8686324 AGATTTGAACACAGCTAACTTGG + Intronic
1051365579 9:16319292-16319314 AGGTTTCAACATAGGAATCTGGG - Intergenic
1051763898 9:20500895-20500917 AGAGTGTAACCCAGGTTTCTGGG - Intronic
1054314847 9:63571205-63571227 AGATAGCAACACAGCTAACGTGG + Intergenic
1056151416 9:83793854-83793876 AGATTTCATGACAGGTAGCTAGG - Intronic
1056690969 9:88808433-88808455 AAATTGCAAGACATGTATCCTGG + Intergenic
1057707064 9:97402420-97402442 AGGTTTCAAAACAGGAATCTGGG + Intergenic
1058889501 9:109348783-109348805 AGATTCAAACTCAGGTGTCTTGG - Intergenic
1059489450 9:114655103-114655125 AGATTTCAACACATGAATTTGGG - Intergenic
1060028187 9:120190755-120190777 ATATTACAACCCAGGTCTCTGGG + Intergenic
1060404739 9:123367673-123367695 AGATGGCTACGCAGGTGTCTGGG + Exonic
1189548823 X:42072161-42072183 GGATTTCAACATAGGAATCTGGG - Intergenic
1190373502 X:49765748-49765770 GGATTCCAACTCAGGTTTCTTGG + Intergenic
1191735517 X:64384552-64384574 AGATTGCAAAAGAGGAAGCTTGG - Intronic
1192231244 X:69266567-69266589 AGATTGAAACACATGAATTTGGG - Intergenic
1192924616 X:75742505-75742527 TGGTTGCCATACAGGTATCTTGG - Intergenic
1194494740 X:94600412-94600434 AGATTGAAACAGAGATTTCTCGG + Intergenic
1195630335 X:107049201-107049223 AGATTGCAAGAGATTTATCTCGG + Intergenic
1196777622 X:119354417-119354439 TGGTGGCAACACAGGTTTCTGGG + Intergenic
1197013154 X:121591696-121591718 AGGTTTCAACACATGTATTTTGG - Intergenic
1200374442 X:155765139-155765161 AGGTTTCAACACAGGAATTTTGG + Intergenic
1202389593 Y:24356273-24356295 AGATTGCAACCCAGATATCCTGG + Intergenic
1202481191 Y:25313841-25313863 AGATTGCAACCCAGATATCCTGG - Intergenic