ID: 903734394

View in Genome Browser
Species Human (GRCh38)
Location 1:25521046-25521068
Sequence ACAGCCAATAAGTGGTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903734394_903734397 -2 Left 903734394 1:25521046-25521068 CCAGCTGACCACTTATTGGCTGT No data
Right 903734397 1:25521067-25521089 GTGGTCTCTCTACATCTCTAAGG No data
903734394_903734399 27 Left 903734394 1:25521046-25521068 CCAGCTGACCACTTATTGGCTGT No data
Right 903734399 1:25521096-25521118 TGAGCTTCACTTTCCCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903734394 Original CRISPR ACAGCCAATAAGTGGTCAGC TGG (reversed) Intergenic
No off target data available for this crispr