ID: 903734399

View in Genome Browser
Species Human (GRCh38)
Location 1:25521096-25521118
Sequence TGAGCTTCACTTTCCCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903734396_903734399 19 Left 903734396 1:25521054-25521076 CCACTTATTGGCTGTGGTCTCTC No data
Right 903734399 1:25521096-25521118 TGAGCTTCACTTTCCCCATCTGG No data
903734394_903734399 27 Left 903734394 1:25521046-25521068 CCAGCTGACCACTTATTGGCTGT No data
Right 903734399 1:25521096-25521118 TGAGCTTCACTTTCCCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903734399 Original CRISPR TGAGCTTCACTTTCCCCATC TGG Intergenic
No off target data available for this crispr