ID: 903735883

View in Genome Browser
Species Human (GRCh38)
Location 1:25529794-25529816
Sequence CTCCATCTACAAATGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903735883_903735894 19 Left 903735883 1:25529794-25529816 CCTTTCTTCATTTGTAGATGGAG No data
Right 903735894 1:25529836-25529858 CAGGGAATAACTGAGAAGAGGGG No data
903735883_903735893 18 Left 903735883 1:25529794-25529816 CCTTTCTTCATTTGTAGATGGAG No data
Right 903735893 1:25529835-25529857 CCAGGGAATAACTGAGAAGAGGG No data
903735883_903735891 17 Left 903735883 1:25529794-25529816 CCTTTCTTCATTTGTAGATGGAG No data
Right 903735891 1:25529834-25529856 CCCAGGGAATAACTGAGAAGAGG No data
903735883_903735886 0 Left 903735883 1:25529794-25529816 CCTTTCTTCATTTGTAGATGGAG No data
Right 903735886 1:25529817-25529839 GCGCCTACGGCATCTGCCCCAGG No data
903735883_903735895 30 Left 903735883 1:25529794-25529816 CCTTTCTTCATTTGTAGATGGAG No data
Right 903735895 1:25529847-25529869 TGAGAAGAGGGGCGTGCTCACGG No data
903735883_903735887 1 Left 903735883 1:25529794-25529816 CCTTTCTTCATTTGTAGATGGAG No data
Right 903735887 1:25529818-25529840 CGCCTACGGCATCTGCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903735883 Original CRISPR CTCCATCTACAAATGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr