ID: 903736984

View in Genome Browser
Species Human (GRCh38)
Location 1:25536208-25536230
Sequence CTTCACATGGAGCATGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903736984_903737001 28 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903737001 1:25536259-25536281 GTGAGTGCTGGAGTGGCATTGGG No data
903736984_903736993 6 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903736993 1:25536237-25536259 GAAGGGAGCAACCCCACCTGGGG No data
903736984_903736998 21 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903736998 1:25536252-25536274 ACCTGGGGTGAGTGCTGGAGTGG No data
903736984_903737000 27 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903737000 1:25536258-25536280 GGTGAGTGCTGGAGTGGCATTGG No data
903736984_903736994 16 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903736994 1:25536247-25536269 ACCCCACCTGGGGTGAGTGCTGG No data
903736984_903736991 4 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903736991 1:25536235-25536257 GAGAAGGGAGCAACCCCACCTGG No data
903736984_903736992 5 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903736992 1:25536236-25536258 AGAAGGGAGCAACCCCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903736984 Original CRISPR CTTCACATGGAGCATGTGTG GGG (reversed) Intergenic
No off target data available for this crispr