ID: 903736993

View in Genome Browser
Species Human (GRCh38)
Location 1:25536237-25536259
Sequence GAAGGGAGCAACCCCACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903736983_903736993 11 Left 903736983 1:25536203-25536225 CCTGTCCCCACACATGCTCCATG No data
Right 903736993 1:25536237-25536259 GAAGGGAGCAACCCCACCTGGGG No data
903736985_903736993 5 Left 903736985 1:25536209-25536231 CCCACACATGCTCCATGTGAAGT No data
Right 903736993 1:25536237-25536259 GAAGGGAGCAACCCCACCTGGGG No data
903736984_903736993 6 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903736993 1:25536237-25536259 GAAGGGAGCAACCCCACCTGGGG No data
903736981_903736993 29 Left 903736981 1:25536185-25536207 CCTTAACCATAGCGATGTCCTGT No data
Right 903736993 1:25536237-25536259 GAAGGGAGCAACCCCACCTGGGG No data
903736990_903736993 -7 Left 903736990 1:25536221-25536243 CCATGTGAAGTATGGAGAAGGGA No data
Right 903736993 1:25536237-25536259 GAAGGGAGCAACCCCACCTGGGG No data
903736986_903736993 4 Left 903736986 1:25536210-25536232 CCACACATGCTCCATGTGAAGTA No data
Right 903736993 1:25536237-25536259 GAAGGGAGCAACCCCACCTGGGG No data
903736982_903736993 23 Left 903736982 1:25536191-25536213 CCATAGCGATGTCCTGTCCCCAC No data
Right 903736993 1:25536237-25536259 GAAGGGAGCAACCCCACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903736993 Original CRISPR GAAGGGAGCAACCCCACCTG GGG Intergenic
No off target data available for this crispr