ID: 903736994

View in Genome Browser
Species Human (GRCh38)
Location 1:25536247-25536269
Sequence ACCCCACCTGGGGTGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903736985_903736994 15 Left 903736985 1:25536209-25536231 CCCACACATGCTCCATGTGAAGT No data
Right 903736994 1:25536247-25536269 ACCCCACCTGGGGTGAGTGCTGG No data
903736990_903736994 3 Left 903736990 1:25536221-25536243 CCATGTGAAGTATGGAGAAGGGA No data
Right 903736994 1:25536247-25536269 ACCCCACCTGGGGTGAGTGCTGG No data
903736984_903736994 16 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903736994 1:25536247-25536269 ACCCCACCTGGGGTGAGTGCTGG No data
903736986_903736994 14 Left 903736986 1:25536210-25536232 CCACACATGCTCCATGTGAAGTA No data
Right 903736994 1:25536247-25536269 ACCCCACCTGGGGTGAGTGCTGG No data
903736983_903736994 21 Left 903736983 1:25536203-25536225 CCTGTCCCCACACATGCTCCATG No data
Right 903736994 1:25536247-25536269 ACCCCACCTGGGGTGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903736994 Original CRISPR ACCCCACCTGGGGTGAGTGC TGG Intergenic
No off target data available for this crispr