ID: 903736998

View in Genome Browser
Species Human (GRCh38)
Location 1:25536252-25536274
Sequence ACCTGGGGTGAGTGCTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903736990_903736998 8 Left 903736990 1:25536221-25536243 CCATGTGAAGTATGGAGAAGGGA No data
Right 903736998 1:25536252-25536274 ACCTGGGGTGAGTGCTGGAGTGG No data
903736983_903736998 26 Left 903736983 1:25536203-25536225 CCTGTCCCCACACATGCTCCATG No data
Right 903736998 1:25536252-25536274 ACCTGGGGTGAGTGCTGGAGTGG No data
903736985_903736998 20 Left 903736985 1:25536209-25536231 CCCACACATGCTCCATGTGAAGT No data
Right 903736998 1:25536252-25536274 ACCTGGGGTGAGTGCTGGAGTGG No data
903736986_903736998 19 Left 903736986 1:25536210-25536232 CCACACATGCTCCATGTGAAGTA No data
Right 903736998 1:25536252-25536274 ACCTGGGGTGAGTGCTGGAGTGG No data
903736984_903736998 21 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903736998 1:25536252-25536274 ACCTGGGGTGAGTGCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903736998 Original CRISPR ACCTGGGGTGAGTGCTGGAG TGG Intergenic
No off target data available for this crispr