ID: 903737001

View in Genome Browser
Species Human (GRCh38)
Location 1:25536259-25536281
Sequence GTGAGTGCTGGAGTGGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903736985_903737001 27 Left 903736985 1:25536209-25536231 CCCACACATGCTCCATGTGAAGT No data
Right 903737001 1:25536259-25536281 GTGAGTGCTGGAGTGGCATTGGG No data
903736984_903737001 28 Left 903736984 1:25536208-25536230 CCCCACACATGCTCCATGTGAAG No data
Right 903737001 1:25536259-25536281 GTGAGTGCTGGAGTGGCATTGGG No data
903736990_903737001 15 Left 903736990 1:25536221-25536243 CCATGTGAAGTATGGAGAAGGGA No data
Right 903737001 1:25536259-25536281 GTGAGTGCTGGAGTGGCATTGGG No data
903736986_903737001 26 Left 903736986 1:25536210-25536232 CCACACATGCTCCATGTGAAGTA No data
Right 903737001 1:25536259-25536281 GTGAGTGCTGGAGTGGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903737001 Original CRISPR GTGAGTGCTGGAGTGGCATT GGG Intergenic
No off target data available for this crispr