ID: 903740477

View in Genome Browser
Species Human (GRCh38)
Location 1:25555870-25555892
Sequence CCACTCTAGTTGGGTATAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903740473_903740477 -10 Left 903740473 1:25555857-25555879 CCTCAAGGAGCTTCCACTCTAGT 0: 1
1: 3
2: 70
3: 425
4: 1615
Right 903740477 1:25555870-25555892 CCACTCTAGTTGGGTATAGTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
903740468_903740477 20 Left 903740468 1:25555827-25555849 CCAGATGAGGACTCCAATCCTGC 0: 1
1: 0
2: 0
3: 9
4: 116
Right 903740477 1:25555870-25555892 CCACTCTAGTTGGGTATAGTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
903740472_903740477 -9 Left 903740472 1:25555856-25555878 CCCTCAAGGAGCTTCCACTCTAG 0: 1
1: 11
2: 76
3: 527
4: 1815
Right 903740477 1:25555870-25555892 CCACTCTAGTTGGGTATAGTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
903740471_903740477 2 Left 903740471 1:25555845-25555867 CCTGCTCATTGCCCTCAAGGAGC 0: 1
1: 1
2: 2
3: 27
4: 231
Right 903740477 1:25555870-25555892 CCACTCTAGTTGGGTATAGTCGG 0: 1
1: 0
2: 0
3: 4
4: 63
903740469_903740477 7 Left 903740469 1:25555840-25555862 CCAATCCTGCTCATTGCCCTCAA 0: 1
1: 0
2: 1
3: 24
4: 169
Right 903740477 1:25555870-25555892 CCACTCTAGTTGGGTATAGTCGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903740477 Original CRISPR CCACTCTAGTTGGGTATAGT CGG Intronic
902133151 1:14281196-14281218 CCACTCTAGTTGGGTTTCCCTGG + Intergenic
902150571 1:14439732-14439754 CCACTCATGTTGGGCATTGTAGG - Intergenic
903740477 1:25555870-25555892 CCACTCTAGTTGGGTATAGTCGG + Intronic
904846551 1:33423011-33423033 CTAGTCTTCTTGGGTATAGTGGG - Intronic
907270825 1:53290060-53290082 CCAGTCCAGTTGGGGAAAGTGGG - Intronic
908393146 1:63701506-63701528 CCTCTCTAGTTGGGCAAATTTGG + Intergenic
912424630 1:109576370-109576392 CTACTCTAGTTTTTTATAGTTGG + Intronic
912999754 1:114568243-114568265 CCATTCTAGTTGGGTATCCCTGG - Exonic
915296519 1:154925327-154925349 CCACTCCAGTTGGGGTTAGCAGG - Intronic
922259481 1:223924782-223924804 CCACACTTGTTGGGTGTTGTGGG - Intergenic
922682316 1:227610787-227610809 CCACTCAAGTAGGGCATAGAAGG + Intronic
1068875770 10:61995091-61995113 ACACTCTAGTTGGTTGTAGCTGG - Intronic
1072921790 10:99583020-99583042 CCACCTTAGTTGGGTTTGGTGGG + Intergenic
1075421483 10:122304344-122304366 CCACTCTATGTGGTTATGGTGGG - Intronic
1079084514 11:17435722-17435744 CCACTCCAGATTGGTATAGCTGG + Intronic
1082187701 11:49204539-49204561 CCACTCTAATAATGTATAGTAGG - Intronic
1089870337 11:121666993-121667015 ACACTCTATCAGGGTATAGTGGG - Intergenic
1090761418 11:129839909-129839931 CCACACCAGTTGTGTATATTAGG + Intronic
1098982030 12:76966732-76966754 CCACTATATTTGGTTAAAGTGGG + Intergenic
1102765041 12:115425445-115425467 ACACTGGAGTTGGGAATAGTGGG + Intergenic
1105685258 13:22774871-22774893 CCACCCTAGTTGGTTGTAGAAGG + Intergenic
1107653981 13:42573803-42573825 CCATTCTAGTTTGGTAGAGAAGG - Intronic
1110693628 13:78461138-78461160 CCACTCCAATTGGGTAGAGTTGG + Intergenic
1115836531 14:37411550-37411572 CCACTCTAGTTCTCTATGGTTGG + Intronic
1125764051 15:42121169-42121191 CCACTCTATTGGGCAATAGTTGG + Intergenic
1127710179 15:61589325-61589347 CCACTCGACTAGGATATAGTTGG - Intergenic
1127760849 15:62137789-62137811 CCAATCTAGGTGGATATAGTTGG - Intergenic
1144774290 17:17777252-17777274 CCAATCTAGTTGGGGATGGGAGG - Intronic
1145850014 17:28084070-28084092 CCACTTGAGTTAAGTATAGTGGG + Intronic
1148253732 17:46109253-46109275 CCATTCAAGTTGTGTATGGTTGG - Intronic
1154042213 18:10867001-10867023 CCACTCTTAGTGGGTAAAGTGGG - Intronic
1155187085 18:23396532-23396554 CCACTCTAATTGGGTGTATTTGG + Intronic
1156649422 18:39206865-39206887 TCCCTCTAGTGGGATATAGTGGG - Intergenic
1161932735 19:7351607-7351629 CCACTCTAGCTGGGCACAGTGGG - Intronic
1168015324 19:53568369-53568391 CTTCTCTAGTTGGCGATAGTTGG - Intronic
931510151 2:62982542-62982564 CCACTCTTCTAGGGTCTAGTAGG + Intronic
1172747598 20:37224727-37224749 CTACCCTAGTTGAGTAAAGTTGG - Intronic
1178709712 21:34905352-34905374 CCACTCTAATTGGGAAAGGTGGG - Intronic
1181349352 22:22244293-22244315 TCACTCTACTTGGTTCTAGTAGG + Intergenic
1183321864 22:37169819-37169841 CCACTTTAGTTGGGGAGAGAAGG - Intronic
954306116 3:49726375-49726397 CCACTGAAGTGGGGGATAGTCGG - Exonic
958630277 3:96674539-96674561 CCACTCTAATTGTTTATAATGGG + Intergenic
959523256 3:107344874-107344896 CCACTCTAATTGGGCTGAGTGGG + Intergenic
969228650 4:5815016-5815038 CCAGTTGAGTTGGGTTTAGTGGG - Intronic
969297387 4:6278006-6278028 CCACCCTAGTTGGTTACAGAGGG - Intronic
971386210 4:26142490-26142512 ACACTCTAGTTGGGAGTAGAAGG + Intergenic
971822300 4:31573667-31573689 ACCCACTAGTTGGGTATAGAAGG + Intergenic
980092711 4:128459027-128459049 ACACTTGAGTTGGGCATAGTGGG - Intergenic
986157772 5:5193722-5193744 TCACTCAAATTGGGTGTAGTTGG + Intronic
989755625 5:44949601-44949623 CTACTCTTGTTGAGTGTAGTTGG + Intergenic
1020145393 7:5638483-5638505 ACACTGTAATTGGGCATAGTGGG - Intronic
1021140136 7:17013896-17013918 CCACTCTAGTCAGGTCTTGTGGG - Intergenic
1022287791 7:28971455-28971477 TAACTCTAATTGGGTATAGATGG - Intergenic
1022893503 7:34725400-34725422 CCACTCTAGTTGGTAAGTGTTGG + Intronic
1031078636 7:117237843-117237865 CAGCTCTAGTTGGCTGTAGTAGG + Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1037279545 8:17222706-17222728 CCACTTTATTAGGGTATATTAGG - Exonic
1040816875 8:51517887-51517909 CCACTCTATTTCTTTATAGTTGG + Intronic
1045207502 8:100057179-100057201 CCACTCTAATTGGGAAAAATTGG - Intronic
1045448728 8:102296544-102296566 CCCCTGTAGTGGGGTATACTAGG - Intronic
1045756074 8:105543850-105543872 CCACATAACTTGGGTATAGTTGG + Intronic
1051169579 9:14306858-14306880 CCACCCTCTCTGGGTATAGTAGG - Intronic
1051797814 9:20893811-20893833 CCACTCTGGTGGGGGATAATGGG - Intronic
1052782321 9:32794303-32794325 CAACTATTGTTGGGTAAAGTTGG - Intergenic
1056535331 9:87522166-87522188 CCATTCTAGTTAAGTATTGTTGG - Intronic
1057454642 9:95197247-95197269 CCACTGCACTTGGCTATAGTTGG - Intronic
1187630698 X:21167719-21167741 CCACTCTGGATGGATATATTGGG - Intergenic
1192880616 X:75279454-75279476 CCAGTCTAGTTAGGTATACCAGG - Intronic