ID: 903740608

View in Genome Browser
Species Human (GRCh38)
Location 1:25556411-25556433
Sequence GGCCCACTGGGGCTCCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903740599_903740608 11 Left 903740599 1:25556377-25556399 CCATGCAGAGGGAGTTGCTGTGT 0: 1
1: 0
2: 0
3: 28
4: 227
Right 903740608 1:25556411-25556433 GGCCCACTGGGGCTCCTTGTTGG 0: 1
1: 0
2: 1
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903740608 Original CRISPR GGCCCACTGGGGCTCCTTGT TGG Intronic
900172273 1:1274761-1274783 GGCCCTCTGGGACACCTTGGTGG + Intergenic
900350280 1:2231136-2231158 GGCCCGATGGCGCTCCCTGTGGG + Intronic
902287439 1:15415902-15415924 GGCCTCCAGGGGCTCCTTGCAGG - Intronic
903228860 1:21909836-21909858 GGCCCACTGGGCCCTCCTGTAGG - Intronic
903740608 1:25556411-25556433 GGCCCACTGGGGCTCCTTGTTGG + Intronic
906102312 1:43271458-43271480 TGCAGACTGGGGCTCCTTGAAGG + Intronic
906627088 1:47334082-47334104 GGCGCACTGGGTCCCCTTGCCGG - Exonic
912756441 1:112328791-112328813 GGCCCACTAGGAGGCCTTGTGGG - Intergenic
914755401 1:150559205-150559227 GTCCCAGTGGGATTCCTTGTGGG + Intronic
914969926 1:152298965-152298987 CACACACTGGGGCTTCTTGTGGG + Intergenic
916572059 1:166036691-166036713 GGCACTCTGGAGCTCTTTGTGGG - Intergenic
917535263 1:175869939-175869961 GAACCACTGGGGCCCCTTGGGGG - Intergenic
918767028 1:188499712-188499734 GCCCCAGTGGGGCTCTTTGTAGG - Intergenic
919978466 1:202628004-202628026 AGCTCCCTGGGGCTCTTTGTTGG - Intronic
920386165 1:205571457-205571479 GGCCCTCTGGGGCTTCCTGCTGG + Intronic
920447942 1:206034154-206034176 TCCCCACTGGTGCTCCTTCTTGG - Intergenic
922499489 1:226085965-226085987 AGCCCACTGTGGCTCCTTGGGGG - Intergenic
1064019700 10:11799288-11799310 AGCCCCCTGGGGCTGCTTCTTGG - Intergenic
1067124923 10:43507791-43507813 GGCCCAATGGCCCACCTTGTAGG - Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1069810775 10:71157967-71157989 GAGCCACTGGGTCTCCTTATTGG - Intergenic
1069814760 10:71186721-71186743 GAGCCACTGGGGGTCCTTCTGGG + Intergenic
1069897791 10:71689630-71689652 AGCCCAGTGGAGCTCCCTGTGGG + Intronic
1070671078 10:78377596-78377618 AGGCCCCTGGGGCTCCCTGTGGG + Intergenic
1071508362 10:86246305-86246327 GGCCCACCTGGGCTCCCTGAGGG + Intronic
1075258674 10:120944841-120944863 TGCCCACCAGGGCTCCTTGCTGG + Intergenic
1076404216 10:130201551-130201573 GGCCCAGTGGGTCACCTAGTTGG + Intergenic
1077342694 11:2033072-2033094 GGCCTGCTGGGGCTCCCTGATGG - Intergenic
1077444187 11:2582687-2582709 GCCACTCTGGGTCTCCTTGTTGG + Intronic
1078576039 11:12503545-12503567 GGTCCCATGGGGCTCCTTCTTGG - Intronic
1078729874 11:13964307-13964329 GGGTCACTGGGGCACCTGGTGGG + Intronic
1079224821 11:18596031-18596053 GGGCCACTGGGATTCTTTGTTGG - Intergenic
1079585850 11:22126415-22126437 AGACCATTGGGGCTCCATGTAGG - Intergenic
1081329737 11:41788544-41788566 GGCCAGCTGGGGCTCCAGGTGGG - Intergenic
1083164192 11:60873528-60873550 GGGCCACTGGGGCTGCTGGAAGG - Exonic
1083255324 11:61491849-61491871 GCCCGGCTGGGGCTCCATGTGGG + Intergenic
1083572715 11:63768811-63768833 GGGCCCCTGGGGCTCCTTTAAGG + Intergenic
1083704059 11:64500966-64500988 GGCCGGCTGGGCCTGCTTGTGGG + Intergenic
1202825680 11_KI270721v1_random:88261-88283 GGCCTGCTGGGGCTCCCTGATGG - Intergenic
1092264035 12:6967757-6967779 GGCCCGCTGGGCCTCCTGCTGGG + Exonic
1096204497 12:49709363-49709385 GGCTCACTGGGCCAACTTGTGGG - Intronic
1096781656 12:53995565-53995587 GGGCCACTGGGGCTCCGGGCAGG + Intronic
1096841079 12:54379439-54379461 CCTCCACTGGGGCTCCTTCTTGG + Intronic
1098051729 12:66461456-66461478 GGCCCACGGGGCCTCCTGATAGG + Intronic
1103361549 12:120357436-120357458 AGAAGACTGGGGCTCCTTGTGGG - Intronic
1103605661 12:122084294-122084316 GGAGCACTGGGGCTTCCTGTTGG - Intronic
1105346626 13:19578832-19578854 CACCCACTGGGGCCTCTTGTGGG + Intergenic
1106556272 13:30810957-30810979 GTGCCACTGAGGCTCCTAGTGGG + Intergenic
1109870594 13:68327489-68327511 GGCACACTGGGGCCTGTTGTGGG - Intergenic
1110848565 13:80218180-80218202 GGCCCACTAAGCTTCCTTGTGGG - Intergenic
1114936797 14:27548868-27548890 GCCCCAGTGGGGCTCTGTGTGGG - Intergenic
1122370255 14:101225583-101225605 GGCCCCCGGGGGGCCCTTGTGGG - Intergenic
1122996335 14:105267230-105267252 GGCCCATGTGGGCCCCTTGTCGG - Intronic
1123475757 15:20591921-20591943 GGTCTACTGGGGGTCCCTGTGGG + Intergenic
1124438710 15:29671867-29671889 GGCAGACGGGGGCTCCTTGGGGG - Intergenic
1128545982 15:68568104-68568126 CACCCCCTGGGGTTCCTTGTAGG + Intergenic
1129656601 15:77528955-77528977 GGCCCCCAGGGCCTCCTTGATGG + Intergenic
1130910855 15:88269944-88269966 GGTGCTGTGGGGCTCCTTGTTGG - Intergenic
1132603525 16:784234-784256 GGCCGACTGGTGCTACTTGAGGG + Intergenic
1132656015 16:1042077-1042099 GGCGCACTGGGGCTCGGTGGAGG - Intergenic
1136568368 16:31082963-31082985 GTGCCACTGGGGCTCCTGGGGGG - Exonic
1138189124 16:54999883-54999905 GGCCCACTGGGGGGCCTTCTCGG - Intergenic
1144639981 17:16931735-16931757 GGCCCACTGGGGCATCCTATAGG - Intronic
1145241032 17:21241205-21241227 GGCCCTCAGGGGCTTCCTGTGGG + Exonic
1147460122 17:40562997-40563019 GGCCCATTGCAGCTCCTTGTTGG + Intronic
1147907300 17:43831730-43831752 GCCCCACTCGGGCTCCTCGGGGG - Intronic
1149682644 17:58516968-58516990 GCCCAACTGGGGCTCATTTTAGG + Intronic
1151365540 17:73614058-73614080 GGCCCACTGGGCCTCCCTGCCGG + Intronic
1158212270 18:55064969-55064991 TGACCACTGGGGCTCCTCCTTGG + Intergenic
1162101523 19:8342278-8342300 AGCCCCCTGAGGCTCCTTGGTGG - Intronic
1164854587 19:31511201-31511223 GGACCACTGGGGGTCCTTGGTGG + Intergenic
1165314465 19:35046178-35046200 GGCCCACTGGGGCCTCTTTTGGG + Intronic
1167097743 19:47383757-47383779 GGCCAACTGGGGCTTATTCTAGG + Intergenic
1168719561 19:58547496-58547518 GACTCACTGGTGGTCCTTGTGGG - Exonic
925114582 2:1367679-1367701 GGGACGCTGGGGCTCCTCGTTGG - Intergenic
926221048 2:10935581-10935603 GGGCCACTGGGGCTCCTCACAGG + Intergenic
934235587 2:90229312-90229334 GGGCCTTTGGGGCTCATTGTTGG + Intergenic
936008269 2:108908890-108908912 GTCCCACTGGGGCTTCATGATGG - Intronic
936489216 2:112956173-112956195 GGCTCATTGTGGCTCCTTGCAGG - Intergenic
938741149 2:134233646-134233668 AGGCCTCTGGGGCTCATTGTAGG + Intronic
938794541 2:134706725-134706747 AGCCCCCAGAGGCTCCTTGTGGG - Intronic
940372411 2:152918055-152918077 GGCCCACTGGAGCCACATGTGGG - Intergenic
941017291 2:160371833-160371855 GGCCCAGTGGGGCTTCTGGCGGG - Intronic
941986570 2:171516922-171516944 ATCCCACTGTGACTCCTTGTTGG - Intergenic
942322074 2:174744455-174744477 GCCATACTGGGGCTCATTGTTGG - Intergenic
948942917 2:241204903-241204925 GGCACACTGGTGTTCCTGGTGGG + Exonic
1168779760 20:478628-478650 GGCCCACTAGGGATTCTTATTGG - Intronic
1170588043 20:17750367-17750389 GGGCCACTGGGGGTCCCTGGAGG - Intergenic
1171169745 20:23005201-23005223 GGTCCACTGGGCTTCCATGTGGG + Intergenic
1172112377 20:32554666-32554688 GGCCCTCTGGGCCTCCTGGGAGG - Intronic
1175445362 20:59016016-59016038 GGCCAACAGGGGCTCCTTTCAGG + Intergenic
1176410898 21:6448908-6448930 AGCCCACGGTGGCTCCTTGCCGG - Intergenic
1178942158 21:36915114-36915136 GCCCCACCTGGGCTTCTTGTGGG + Intronic
1179686391 21:43057230-43057252 AGCCCACGGTGGCTCCTTGCCGG - Intronic
1179881922 21:44296585-44296607 GCAGCACTGGGGCTCCTGGTGGG - Intronic
1181571893 22:23772479-23772501 ATCCCACTGGGTCTCCTTGGTGG - Intronic
1181711688 22:24695451-24695473 GGAAGCCTGGGGCTCCTTGTAGG + Intergenic
1182651364 22:31853915-31853937 GGCACACTGTGGCTCATTGCTGG - Intronic
1183184456 22:36284191-36284213 GGCCCGCTGGGCCTCCTCTTCGG + Exonic
1184230319 22:43155215-43155237 GGCCCACTCGGCCTCCATGGTGG - Intronic
1185062383 22:48613812-48613834 GGCCCCCTCGAGCTCCTGGTGGG + Intronic
950785024 3:15427402-15427424 GGCCCAGTGGGGCTGGCTGTGGG - Exonic
953408510 3:42673245-42673267 GGCCCACTGGAGCTTCATCTTGG - Intergenic
953709676 3:45259630-45259652 GGCCCCCTGGAGCCCCTTCTGGG + Intergenic
955650666 3:61190912-61190934 CACCCACTGGGGCTTGTTGTGGG + Intronic
963042062 3:141077343-141077365 CGCCCACTGGGGCTCCCAGCAGG - Intronic
963078618 3:141370847-141370869 AGACCACTGGGGCTCATAGTTGG - Intronic
967323856 3:188219706-188219728 GGTCCACTGTGGGTCCATGTGGG + Intronic
968691652 4:1993263-1993285 GCTCTACTGGGGCTTCTTGTAGG + Intronic
968704880 4:2073190-2073212 GGCACTCAGGGGCTCCTTGTGGG - Intronic
969251240 4:5970162-5970184 GGCCCACTGGGGCTAGGGGTCGG + Intronic
972301795 4:37791919-37791941 AGCCCTCTGGGCCTCCTTCTTGG - Intergenic
975191475 4:71467859-71467881 GGCCTGCTGGCACTCCTTGTTGG + Intronic
975900658 4:79147947-79147969 GGGCTACTGGGGCTCCTGGATGG - Intergenic
988052953 5:26054481-26054503 GTCCCAGTGGGGCTCTATGTGGG + Intergenic
989257525 5:39381459-39381481 GCCCCAGTGGGGCCCCTGGTGGG - Exonic
994074221 5:95632968-95632990 CACACACTGGGGCCCCTTGTTGG - Intergenic
995398703 5:111717037-111717059 GGGCCACTGGAGCTTGTTGTGGG - Intronic
997473114 5:134127676-134127698 GCCCCACTGGGGCACGTTGAGGG + Intronic
998723017 5:144975673-144975695 GCCCCACTGGGACTCTGTGTGGG - Intergenic
999697624 5:154200380-154200402 GGCCGACAGGGGCTCCTGGAGGG + Intronic
999776169 5:154814516-154814538 GGCCCGCAGGGCCTTCTTGTGGG - Exonic
1001804733 5:174573650-174573672 GACCCACGGAGGCTGCTTGTGGG + Intergenic
1002780154 6:359292-359314 GGCCCACAGGGGCTGCTCGGTGG + Intergenic
1006450582 6:34103671-34103693 TGCCCCTTGGGGCTCCTTGCTGG - Intronic
1006817484 6:36862233-36862255 GCCCCACTGGCTCTCCTTATAGG - Intronic
1008563960 6:52749309-52749331 GGCTCACTGGGGCTCTGTGGAGG + Intergenic
1015549058 6:134393279-134393301 GGTTCCCTGGGGCTCCTGGTAGG + Intergenic
1015808293 6:137133983-137134005 GGGCCACTGCAGCTGCTTGTAGG + Intergenic
1017587960 6:155947466-155947488 GGCCCACTGTGGCTGCCTGTGGG + Intergenic
1019221669 6:170478300-170478322 GGTCCACTGGGGCTCCCCTTGGG - Intergenic
1019273181 7:161991-162013 GGCCCACAGGTGCTGCTTCTGGG - Intergenic
1022083933 7:27048558-27048580 GGCCTCCTGGTACTCCTTGTGGG - Intergenic
1022442525 7:30446026-30446048 GGACCACTGGGGCTCGCTGTCGG - Intronic
1023008805 7:35906594-35906616 GAACCACTTGGGCACCTTGTGGG + Exonic
1023016742 7:35976014-35976036 GAACCACTTGGGCACCTTGTGGG + Intergenic
1026118692 7:67517997-67518019 TGCCCACTGGGGCCCATTGAGGG - Intergenic
1032364512 7:131286805-131286827 GGCCCATTGGGGCTCCTTTTGGG - Intronic
1035648904 8:1249266-1249288 GGGCCACTGGGCCTCTCTGTGGG + Intergenic
1035653988 8:1291757-1291779 GGCCCCCGGGGGCTCAATGTTGG - Intergenic
1035870628 8:3133227-3133249 GTCCCAATGGGGCCCCTTCTTGG + Intronic
1036079950 8:5544087-5544109 GGGTCACTGGGGCTCCTTGGAGG + Intergenic
1036752090 8:11449784-11449806 GGCCCACAGCGGCTCCTTGGAGG + Intronic
1037547710 8:19939999-19940021 GGCCGACTGTGGCCCCTTCTGGG + Intronic
1037767815 8:21782697-21782719 GGCCGCCTGGCACTCCTTGTTGG + Exonic
1039946006 8:42129200-42129222 GGCCCACTGTGGCTTCTCGGTGG + Intergenic
1042849064 8:73197742-73197764 GCCACACTGGGGATCTTTGTAGG + Intergenic
1045021095 8:98045211-98045233 GGGCCACTGGGATTCCTTCTGGG + Intronic
1048986718 8:139738751-139738773 GGCTGACTGGGGCCCCTTGGGGG - Intronic
1049683492 8:143930152-143930174 GGCCTCCTGGGCCTCCTGGTTGG + Exonic
1053404584 9:37861160-37861182 GTCGCACTGGAGCTCCTTCTTGG - Exonic
1057546986 9:96026297-96026319 CGCCCTCTGGGGCCCCCTGTTGG + Intergenic
1058314968 9:103554127-103554149 GACCCACTGGAGCTCCCTATTGG - Intergenic
1059856456 9:118403508-118403530 GGCCCACTGGGTCTCCTACTTGG - Intergenic
1060663138 9:125416013-125416035 GGCCCACTGGGTCTCCCATTCGG - Intergenic
1060809572 9:126603660-126603682 TTCCCACTGGGGCCCATTGTGGG - Intergenic
1061015410 9:127978428-127978450 TGCTCCCTGGGCCTCCTTGTGGG - Intronic
1061826003 9:133258540-133258562 AGCCTGCTGGGCCTCCTTGTGGG + Intronic
1061970912 9:134045051-134045073 GGACCACTGGGGCTCTGTGGGGG - Intronic
1062097639 9:134711162-134711184 GGCCCACAGGGGCTTCTTCCAGG - Intronic
1062358229 9:136175180-136175202 AGCCCACGGGGGCTCCAGGTTGG - Intergenic
1186374952 X:8988829-8988851 GGACCTGTGGGGCTCCATGTGGG + Intergenic
1189629040 X:42932274-42932296 GAACCACTGTGGCTCCTTTTGGG - Intergenic
1195245523 X:102991895-102991917 GGGCCACTGGGCATCCTTGATGG - Intergenic