ID: 903740926

View in Genome Browser
Species Human (GRCh38)
Location 1:25558035-25558057
Sequence CCAGCTAAGATGTGGTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903740926_903740935 -5 Left 903740926 1:25558035-25558057 CCCCCTGACCACATCTTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 903740935 1:25558053-25558075 GCTGGGATGAGTGGGAACCTTGG 0: 1
1: 0
2: 2
3: 36
4: 306
903740926_903740937 4 Left 903740926 1:25558035-25558057 CCCCCTGACCACATCTTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 903740937 1:25558062-25558084 AGTGGGAACCTTGGTGGTCACGG 0: 1
1: 0
2: 0
3: 12
4: 162
903740926_903740940 7 Left 903740926 1:25558035-25558057 CCCCCTGACCACATCTTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 903740940 1:25558065-25558087 GGGAACCTTGGTGGTCACGGGGG 0: 1
1: 0
2: 1
3: 10
4: 118
903740926_903740939 6 Left 903740926 1:25558035-25558057 CCCCCTGACCACATCTTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 903740939 1:25558064-25558086 TGGGAACCTTGGTGGTCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 109
903740926_903740944 26 Left 903740926 1:25558035-25558057 CCCCCTGACCACATCTTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 903740944 1:25558084-25558106 GGGGATTTGTCCTGAATTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 140
903740926_903740938 5 Left 903740926 1:25558035-25558057 CCCCCTGACCACATCTTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 903740938 1:25558063-25558085 GTGGGAACCTTGGTGGTCACGGG 0: 1
1: 0
2: 0
3: 3
4: 126
903740926_903740936 -2 Left 903740926 1:25558035-25558057 CCCCCTGACCACATCTTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 903740936 1:25558056-25558078 GGGATGAGTGGGAACCTTGGTGG 0: 1
1: 1
2: 0
3: 22
4: 204
903740926_903740943 25 Left 903740926 1:25558035-25558057 CCCCCTGACCACATCTTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 903740943 1:25558083-25558105 GGGGGATTTGTCCTGAATTTGGG 0: 1
1: 0
2: 0
3: 8
4: 119
903740926_903740942 24 Left 903740926 1:25558035-25558057 CCCCCTGACCACATCTTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 903740942 1:25558082-25558104 CGGGGGATTTGTCCTGAATTTGG 0: 1
1: 0
2: 0
3: 5
4: 69
903740926_903740945 27 Left 903740926 1:25558035-25558057 CCCCCTGACCACATCTTAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
Right 903740945 1:25558085-25558107 GGGATTTGTCCTGAATTTGGGGG 0: 1
1: 0
2: 0
3: 19
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903740926 Original CRISPR CCAGCTAAGATGTGGTCAGG GGG (reversed) Intronic
901474484 1:9480165-9480187 CCAGCTAAGGTGTGGACAGATGG + Intergenic
903740926 1:25558035-25558057 CCAGCTAAGATGTGGTCAGGGGG - Intronic
903808428 1:26021476-26021498 CCAGCTAAGAAGTGGCAGGGTGG - Intronic
905362792 1:37431875-37431897 CCAGCTTAGATGTGGGAGGGTGG - Intergenic
908253697 1:62285256-62285278 CCAGCAAAGAAGTGGTCACTTGG + Intronic
910821855 1:91359226-91359248 CCAGCTAAGAACTGGGCTGGAGG + Intronic
914007171 1:143742464-143742486 CAAGTTAAGATTTGGTCATGGGG - Intergenic
914645989 1:149652958-149652980 CAAGTTAAGATTTGGTCATGGGG - Intergenic
915375177 1:155388126-155388148 CCAACTAAAATGGAGTCAGGAGG + Intronic
915661407 1:157408726-157408748 CCAATTAAGATGAGGTCACGAGG - Intergenic
918905993 1:190494710-190494732 TCAGATTAGATGTAGTCAGGAGG - Intergenic
920302330 1:204996739-204996761 CCAGCCTAGAGGTGGGCAGGCGG - Intronic
1067143535 10:43676583-43676605 CTCACTAAGATGGGGTCAGGAGG - Intergenic
1071131391 10:82397710-82397732 CCAGGAAATATGTGGTAAGGAGG + Intronic
1072516698 10:96190414-96190436 CAAGGTAAGATGAGGTCAGTAGG - Intronic
1073859856 10:107725573-107725595 CCTGCAATGATGTGCTCAGGAGG + Intergenic
1074095755 10:110310897-110310919 GCAGGAAAGATGTGGGCAGGAGG + Intergenic
1074426159 10:113353353-113353375 CAAGCTAAGATGAGGTCATTAGG + Intergenic
1074576631 10:114675985-114676007 CAAGTTAAGATGAGGTCATGAGG - Intronic
1076279774 10:129236554-129236576 ACAGCTGGGATGTTGTCAGGAGG + Intergenic
1076501349 10:130938874-130938896 CCAGCTATGCTCTGGGCAGGGGG - Intergenic
1077393848 11:2311706-2311728 CCAGGGAAGATCTGGTCATGGGG + Intronic
1078090268 11:8260766-8260788 CCAGACAAGATGCTGTCAGGTGG + Intronic
1080008023 11:27429974-27429996 CCTGCTGAGGTGTGGTCAGCTGG - Intronic
1081659720 11:44880576-44880598 TCAGCTGAGCTGTGATCAGGTGG - Intronic
1083014728 11:59441554-59441576 CCAGGAAAAATGTGGTCAGAGGG - Intergenic
1084012851 11:66362346-66362368 CCAGCTATCATGTGGTCCAGAGG + Intronic
1086506451 11:87509356-87509378 GCAGCTAAGAAGTAGTGAGGGGG + Intergenic
1086993916 11:93335065-93335087 GCAGCAAAGCTGTGCTCAGGAGG - Intronic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1091408200 12:221788-221810 CCAGGTAGGATGTGATCATGTGG + Intronic
1092577156 12:9798246-9798268 CCTGCTACTGTGTGGTCAGGAGG + Intergenic
1093460465 12:19402973-19402995 CCAGCTCTGATGGGGTCAGGAGG + Intergenic
1093573223 12:20693605-20693627 CAAGTTAAGATGAGGTCATGAGG + Intergenic
1095583266 12:43824320-43824342 CCAGCTAATTTGTGATTAGGAGG + Intergenic
1096868347 12:54578263-54578285 CCAGCTAAGATCTGGGGTGGGGG - Exonic
1097868603 12:64580864-64580886 CAAGTTAAGATGAGGTCAGTAGG - Intergenic
1100481408 12:94983202-94983224 CCAAGTAAGATGGGGTCAGCAGG - Intronic
1102009713 12:109610792-109610814 CAAGTTAAGATGAGGTCATGAGG - Intergenic
1103548760 12:121720930-121720952 ACAGCCAAGATGTGTTAAGGAGG + Intronic
1104062073 12:125277126-125277148 CAAGTTAAGATGTGGTCATTAGG + Intronic
1111164222 13:84436966-84436988 CCAGCTAAGATGTGCTGAACTGG + Intergenic
1111862255 13:93722945-93722967 CAAGTTAAGATGAGGTCATGGGG - Intronic
1112052115 13:95653291-95653313 CTATCAAAGATGTGGTGAGGAGG + Intergenic
1113223660 13:108134726-108134748 CAAGTTAAGATGAGGTCAGCAGG + Intergenic
1113947369 13:114051685-114051707 ACAGCCAAGACGTGGTGAGGAGG + Intronic
1120576157 14:86183572-86183594 CCAGCTCAGCTGTACTCAGGAGG - Intergenic
1122066901 14:99180120-99180142 CCAGCTCACCTGTGGGCAGGTGG - Intronic
1123945441 15:25236698-25236720 CCAGCTAAGATGCGGTGATCTGG + Intergenic
1125100419 15:35906123-35906145 CCAGATAAGATGTTTTCAGAAGG + Intergenic
1129296372 15:74602437-74602459 CCAGCTTAGAGGTGGGCGGGGGG + Intronic
1130108937 15:80949282-80949304 CCAGCTAGGAGGTAGTCTGGAGG + Exonic
1130222285 15:82029850-82029872 CCAGTTAAAATGAGGTCATGAGG + Intergenic
1132376198 15:101329865-101329887 CCAGCGAGGATGGGGGCAGGAGG - Intronic
1135461024 16:22643021-22643043 CCAGCTAATATCAGGGCAGGTGG + Intergenic
1135502056 16:23004866-23004888 CCTGCTATAATGTGATCAGGAGG - Intergenic
1136353452 16:29727653-29727675 CCAGCCAAGATGGAGTCACGTGG - Intergenic
1136378826 16:29881546-29881568 GCAGCTAAGATCCGATCAGGTGG - Intronic
1137474369 16:48794259-48794281 TCAGTTAAGATGTGGTCATATGG - Intergenic
1138240259 16:55421815-55421837 CCAGCTCAGATGCGGAGAGGAGG - Intronic
1140946008 16:79769042-79769064 CTAGCTAAGGTGTGGGGAGGGGG + Intergenic
1141754725 16:85983473-85983495 CCAGCTAAGAATCGTTCAGGTGG + Intergenic
1144165298 17:12604553-12604575 CCAGTTAAAATGAGGTCATGAGG + Intergenic
1151138844 17:71972590-71972612 CAAGTTAAGATGAGGTCATGAGG - Intergenic
1154332704 18:13442712-13442734 CCCACTAAGATGTGGCCAAGGGG - Intronic
1157706479 18:49812255-49812277 CCAGCTAAGCATTGGTTAGGGGG - Intronic
1158066949 18:53422046-53422068 CCAACTAAAATGGAGTCAGGAGG + Intronic
1163863803 19:19755976-19755998 TCAGCTGAAATGTGGTCAGTGGG - Intergenic
1164089717 19:21937995-21938017 CCAGGTAAGGTGAGGGCAGGAGG + Intronic
1164194032 19:22937928-22937950 CCAGGTAAGGTGAGGACAGGAGG + Intergenic
925231644 2:2238137-2238159 CCAGAGAACATGGGGTCAGGGGG + Intronic
925336327 2:3101727-3101749 CAAGCTAAGATGAGGTCATCAGG + Intergenic
926091513 2:10053502-10053524 CCAGCTAAGCTGTGCTCTGGTGG - Exonic
927554420 2:24022216-24022238 CCTGCTCAGCTGTGATCAGGTGG - Intronic
934037126 2:88097522-88097544 CCAGTGAAGCTGTGCTCAGGGGG + Intronic
934910056 2:98244054-98244076 ACAGCTAGAATGTTGTCAGGTGG + Intronic
937096131 2:119236373-119236395 CCAGCTAGCAAGTGGTCTGGTGG + Intronic
937096267 2:119237249-119237271 CCAGCTAGCAAGTGGTCAGGTGG - Intronic
937459742 2:122075525-122075547 CCAGGTCAGATGTGGTCATGAGG + Intergenic
938222899 2:129587213-129587235 CGAGCTAAGATCTGGACAGGTGG + Intergenic
938972360 2:136444117-136444139 CCAGCTAAAATGTGCTCTGTGGG - Intergenic
940126535 2:150332140-150332162 CCAGCTATGATGTGTTTTGGTGG + Intergenic
943119597 2:183718665-183718687 TAAACTAAGATGTGGTCATGAGG + Intergenic
944480317 2:200151093-200151115 CCAGTTAAGATCAGGACAGGAGG + Intergenic
946248865 2:218401212-218401234 TCAGGTAAGGTGGGGTCAGGAGG + Intronic
946473867 2:219989097-219989119 CAAGTTAAGATGAGGTCATGCGG + Intergenic
946510333 2:220348966-220348988 GCTGCTAAGTTGTTGTCAGGAGG + Intergenic
948607914 2:239147561-239147583 CCAGGCACGATGTGGCCAGGTGG + Intronic
1169520298 20:6364262-6364284 CAAGCTAAGATGCAGTGAGGTGG - Intergenic
1169581938 20:7033553-7033575 CCAGCTAAAATGTTGTTAGGAGG - Intergenic
1172278688 20:33695254-33695276 CCCGCTGCTATGTGGTCAGGTGG + Intergenic
1173822688 20:46029393-46029415 CCGGGTAAGCTGTGGTCCGGGGG + Intronic
1174171777 20:48622045-48622067 CCAGCTGACATGTAGCCAGGTGG + Intergenic
1175242461 20:57559899-57559921 CTACCTAAGATGAGGTCAGGTGG - Intergenic
1175242763 20:57561917-57561939 CCATCTAAGACATGGCCAGGTGG - Intronic
1179128451 21:38613405-38613427 GTAGTTACGATGTGGTCAGGGGG - Intronic
1180754243 22:18149420-18149442 CCACTTAAGAAGGGGTCAGGGGG - Intergenic
1183970382 22:41473118-41473140 CCATCTTAGATGTGGACAGAGGG + Intronic
1185387972 22:50545112-50545134 CCAGCCAGGATGTGGTCTCGAGG + Intergenic
950125351 3:10506814-10506836 GCAGCTCAGAGGTGGGCAGGAGG - Intronic
951111634 3:18811002-18811024 CAAGTTAAGATGAGGTCAGTAGG + Intergenic
957134977 3:76275053-76275075 CCATCTAAAATGTGGTGAGTTGG - Intronic
960254575 3:115498423-115498445 CAAGTTAAGATTTGGTGAGGGGG + Intergenic
960753488 3:120982729-120982751 CCAGCTGTGATGTTGTCAGCTGG + Intronic
960958657 3:123053369-123053391 CCAGTTAAGATGAGGTCATTAGG + Intergenic
962102075 3:132353283-132353305 CAAGCTAAGCTGTGGTCATCTGG - Intronic
962372715 3:134834044-134834066 GCAGCTAAGATGGGGTGTGGTGG + Intronic
964251729 3:154725653-154725675 CAAGCTAAGATGAGGTCATTAGG - Intergenic
967855218 3:194112305-194112327 CCAGGTCAGATGTGGGCAGATGG + Intergenic
968067471 3:195766631-195766653 CCAGCTCAGGTGTGATAAGGTGG + Intronic
970443373 4:16104143-16104165 CAAGTTAAGATGAGGTCATGAGG - Intergenic
979113426 4:116788929-116788951 CCAGCTAAGTTGTGGTTTGCAGG + Intergenic
979756356 4:124345030-124345052 TCATCTAAGATGAGGTCGGGAGG - Intergenic
981901419 4:149869584-149869606 ACAGATATGATGTGGCCAGGAGG - Intergenic
983342888 4:166488248-166488270 TCAGATAAGATGTAGTCAAGAGG - Intergenic
992350266 5:75921206-75921228 GCAGCCGAGATGTGGTCAGTGGG + Intergenic
993503402 5:88685516-88685538 CAAGCTGAGATGAGGTGAGGGGG - Intergenic
997426626 5:133807405-133807427 CCAGCTTATATGGGGTCAAGGGG + Intergenic
999323354 5:150627936-150627958 CCACCTGAGATCTGGTCAGAGGG + Intronic
1006799377 6:36750304-36750326 GCAGCTCAGCTGTGATCAGGTGG - Intronic
1007298839 6:40850307-40850329 TCAGCTCAGATGGGGTCAGAGGG - Intergenic
1013563380 6:111329422-111329444 GAAGCTAAGATGTGGTGCGGGGG - Intronic
1014591511 6:123277484-123277506 TTAGTTAAGATGTGGTCATGGGG + Intronic
1015141452 6:129938420-129938442 CCAACCAAGATGTGGGCACGAGG + Intergenic
1017812515 6:157994276-157994298 TCAGCAAAGCTGAGGTCAGGTGG + Intronic
1019337562 7:492514-492536 CCAGCTCAGCTGAGGTCATGAGG + Intergenic
1023058907 7:36311146-36311168 CCACTAAAGATGTGGCCAGGAGG + Intergenic
1026276971 7:68888237-68888259 TCAGCTAACATGTGGGCAGGAGG + Intergenic
1028455872 7:91037495-91037517 CCTTCTAGGGTGTGGTCAGGTGG + Intronic
1029923532 7:104291598-104291620 CCAGGGAAGATGTGGGGAGGTGG - Intergenic
1031479522 7:122261399-122261421 CCAGCTAAAATGTAGACAGTTGG + Intergenic
1034931681 7:155168263-155168285 CCAGCTGAGATGTGGGCTGGGGG - Intergenic
1040636111 8:49274857-49274879 CCGGCTAAGATGGAGGCAGGCGG - Intergenic
1044389318 8:91630333-91630355 CCAGCACAGCTGGGGTCAGGAGG - Intergenic
1045508108 8:102792972-102792994 CAAGTTAAGATGAGGTCATGAGG + Intergenic
1046915402 8:119673414-119673436 CCAGTGCAGATGTAGTCAGGGGG + Intronic
1049406882 8:142455544-142455566 CCAGCACAGCTGAGGTCAGGAGG + Intronic
1053830545 9:42075216-42075238 CAAGTTAAAATGTAGTCAGGAGG - Intronic
1054600015 9:67112239-67112261 CAAGTTAAAATGTAGTCAGGAGG + Intergenic
1057277958 9:93686297-93686319 CCAGCTAACATGAGGTCAAATGG - Intergenic
1062174193 9:135151820-135151842 CCATCTGAGCTGTGGTCAGCAGG - Intergenic
1062586460 9:137252014-137252036 CCAGGTCAGCTGTGATCAGGGGG - Exonic
1186366094 X:8895250-8895272 CCAGTTAAGATGAGGTCATTAGG + Intergenic
1191054198 X:56225402-56225424 CCAACTAATAGGTGGTAAGGGGG + Intergenic
1199207975 X:145171782-145171804 CCAGCAGAGCTGTGGTCATGTGG - Intergenic
1199841139 X:151650627-151650649 CCAGCCAAGATGGAGTGAGGGGG + Intronic