ID: 903743091

View in Genome Browser
Species Human (GRCh38)
Location 1:25569643-25569665
Sequence GAACTCAATATGTCTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903743090_903743091 -10 Left 903743090 1:25569630-25569652 CCAAAGGCAACTGGAACTCAATA 0: 1
1: 1
2: 1
3: 18
4: 185
Right 903743091 1:25569643-25569665 GAACTCAATATGTCTAAAAATGG 0: 1
1: 0
2: 1
3: 18
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903743091 Original CRISPR GAACTCAATATGTCTAAAAA TGG Intergenic
903743091 1:25569643-25569665 GAACTCAATATGTCTAAAAATGG + Intergenic
905828359 1:41044647-41044669 GGGCTCAATCTGTCTGAAAATGG + Intronic
906135194 1:43494510-43494532 GATCTAAATATTTTTAAAAATGG - Intergenic
908135331 1:61126506-61126528 GAACTCCATATGTTGAAAGATGG - Intronic
908723104 1:67147309-67147331 AAACTCACTATGTGAAAAAATGG - Intronic
908774713 1:67628579-67628601 TATCTCAATATGTCTAAAGCAGG + Intergenic
909063618 1:70906671-70906693 GAATTAAATATGTATAAAAGTGG + Intronic
910208798 1:84773750-84773772 GAACTCCATATGTGAAAGAAAGG + Intergenic
910575676 1:88760622-88760644 GCACTAAATATATCTGAAAAAGG - Intronic
911127728 1:94356121-94356143 GATCTCCTTATGTCTAAACATGG + Intergenic
911619783 1:100053600-100053622 AAAATTAATATGTCTAAAACTGG - Intronic
913333910 1:117690901-117690923 GATCTCAATATAACTAAAAAAGG - Intergenic
915923006 1:159992089-159992111 TAACTCAAGATGTCAAAAAGAGG + Intergenic
918992149 1:191710751-191710773 GAACTCAATTTATTTCAAAATGG - Intergenic
920613205 1:207462841-207462863 TAACAGAATATGTATAAAAATGG + Intronic
924833421 1:247623116-247623138 GAACTGAATATATTTTAAAAAGG + Intergenic
1064856495 10:19773983-19774005 GAACTCTATATGCCTACACAGGG - Intronic
1066039025 10:31526260-31526282 GAAAACAAAATGACTAAAAAGGG + Intronic
1066549496 10:36540087-36540109 GAACTCAATCTGTGTGACAAAGG - Intergenic
1067268449 10:44768062-44768084 AAACTCAATTTGTGTAAAAATGG - Intergenic
1068707107 10:60089170-60089192 GAACTCAACCTGTCCACAAATGG + Intronic
1071688143 10:87784412-87784434 TATCTAAATATCTCTAAAAATGG + Intronic
1072532620 10:96333481-96333503 GAACTCAGTATGTCAAAGAGAGG + Intronic
1073080540 10:100857384-100857406 AAGCTCAACGTGTCTAAAAATGG + Intergenic
1073380498 10:103074465-103074487 GAATTTAATTTGTCTAACAATGG + Intronic
1074175483 10:110996821-110996843 TAACTCACTAAGTGTAAAAATGG + Intronic
1076226606 10:128781579-128781601 GAACTAAATATGGATAAAAATGG - Intergenic
1076275945 10:129198750-129198772 GAACTTAATATTTCTACAATCGG + Intergenic
1079513310 11:21236722-21236744 TAACTGAATGAGTCTAAAAAGGG - Intronic
1080060728 11:27954022-27954044 GAACTCAACATGTCAATAATTGG - Intergenic
1081054882 11:38397389-38397411 GAACTTAACATTTTTAAAAAAGG - Intergenic
1081105620 11:39065187-39065209 CACCTCCATATATCTAAAAAGGG - Intergenic
1081822562 11:46013790-46013812 TATCTAAATATATCTAAAAATGG + Intronic
1082106066 11:48223087-48223109 TCACTTAATGTGTCTAAAAACGG + Intergenic
1082948322 11:58784630-58784652 CAACACAATAGGTATAAAAAGGG + Intergenic
1083821643 11:65174923-65174945 CAACTCAAGATGTCTACAGATGG + Intergenic
1085509326 11:77079922-77079944 AAACTCAAATGGTCTAAAAATGG - Intronic
1085587743 11:77727284-77727306 GAATTCCATATGTTAAAAAAAGG + Intronic
1086509224 11:87538517-87538539 GAACTCAATATCTCTTGAAATGG + Intergenic
1086761350 11:90635252-90635274 GAAGTCAATATGTAGAAAAATGG - Intergenic
1086764069 11:90672944-90672966 GTAATCAAAATGTCTAAATAAGG + Intergenic
1087413398 11:97821725-97821747 GAAGTCATTATGTCTGAAACAGG - Intergenic
1087622298 11:100556051-100556073 GAACAAAATCTGCCTAAAAAGGG - Intergenic
1088107604 11:106224054-106224076 GAACTCAAAATCTCTCTAAAGGG + Intergenic
1092729874 12:11520658-11520680 GAACTCAATGTTTGTAAAACTGG + Intergenic
1093824941 12:23672482-23672504 AAACTCAATTTGTATAAAGAAGG + Intronic
1093868277 12:24255340-24255362 GGACCCAATATTTCTAATAATGG - Intergenic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1097116206 12:56699198-56699220 TTACCCAATAAGTCTAAAAAGGG - Intergenic
1097655407 12:62355734-62355756 AAACTTAAGCTGTCTAAAAAGGG + Intronic
1099540092 12:83896922-83896944 GGAGTCGATATGTATAAAAATGG + Intergenic
1099569174 12:84293599-84293621 AAATTCAATATGTATATAAATGG + Intergenic
1101203643 12:102463261-102463283 AAACTAAATATGTCTATGAACGG + Intronic
1103113052 12:118299332-118299354 GAACTCAAGATAGCTATAAATGG - Intronic
1103843606 12:123885897-123885919 CAACTCAATAAGTATATAAAGGG - Intronic
1105623363 13:22090026-22090048 GAGAGCAATATGTCTCAAAATGG + Intergenic
1107067925 13:36236494-36236516 GAACTCAAAATGGGTGAAAAGGG + Intronic
1107167032 13:37294704-37294726 TTACTCATTATGTCTAAAACTGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1108724518 13:53165163-53165185 AAACTCAAAATGACTACAAAAGG - Intergenic
1109041290 13:57340735-57340757 CAACTCAAAATGACTCAAAATGG + Intergenic
1109778544 13:67076887-67076909 GAAGTAAATATGGCTAATAATGG + Intronic
1109819435 13:67633809-67633831 GTACTCATTATTTCTACAAAAGG + Intergenic
1109878592 13:68439867-68439889 GACCTCATTATGTCTACAGAAGG + Intergenic
1110322855 13:74179608-74179630 GGCATCAATATGTCTTAAAATGG - Intergenic
1110499339 13:76208588-76208610 GAAGTCAATATGTGAAAATATGG - Intergenic
1110683744 13:78347231-78347253 AATCTTAATATGTTTAAAAATGG - Intergenic
1111321170 13:86631553-86631575 GAAAACAATATAACTAAAAATGG - Intergenic
1111324405 13:86674074-86674096 GAAGCCAATATGTCTAGTAAGGG - Intergenic
1111534730 13:89588443-89588465 AAACCAAATATGTCTAAAAATGG + Intergenic
1113052710 13:106231620-106231642 AAACTTAAAATGTCTAAAACAGG - Intergenic
1113329573 13:109315312-109315334 GAAACCAATATTCCTAAAAATGG + Intergenic
1114373573 14:22117782-22117804 GAAATGAATATGGCTACAAAAGG - Intergenic
1115418651 14:33166655-33166677 GAAGGCAATATGTCTATCAAAGG - Intronic
1116162039 14:41280124-41280146 GAACACAATATGTGGAAAATGGG + Intergenic
1116825265 14:49667371-49667393 GAAATCTATATGTAGAAAAATGG - Intronic
1117211318 14:53503420-53503442 GGACTTAATATGTATAAAAAGGG - Intergenic
1120505512 14:85350498-85350520 GAAATCAATAAGTCTCAAATGGG - Intergenic
1120566681 14:86068160-86068182 GAACTAAATATGTCTAGCATTGG + Intergenic
1121197068 14:92083510-92083532 GAAATAAATATGTCTGTAAAGGG + Intronic
1122333351 14:100944497-100944519 GGACTCAACATGTGTAGAAATGG - Intergenic
1128120262 15:65140975-65140997 GAACTGAATGTGGCTATAAAAGG - Intergenic
1129141301 15:73600351-73600373 TTACTCTATATGTCTAATAATGG - Intronic
1129865520 15:78905014-78905036 GAACTCAATAGGTTTAACAGTGG + Intergenic
1135481983 16:22828238-22828260 GAACTCTGTATTTATAAAAAAGG - Intronic
1138938204 16:61756964-61756986 GAACTCAATGGATCTAAAAATGG - Intronic
1140597347 16:76431912-76431934 GAACTCAATGTGTCAAAAACAGG - Intronic
1140674454 16:77313876-77313898 TAACACAATGTATCTAAAAAAGG + Intronic
1145179203 17:20730519-20730541 GAACTAATTATCTCTAAACAGGG + Intergenic
1146017580 17:29246406-29246428 GAACTCAATATGAGAAAAAATGG - Intergenic
1149838860 17:59940160-59940182 GAACTAATTATCTCTAAACAGGG + Intronic
1150080305 17:62232256-62232278 GAACTAATTATCTCTAAACAGGG - Intergenic
1150788457 17:68181108-68181130 GAACCCAGTGTGTCTAAAATCGG - Intergenic
1151538807 17:74753771-74753793 GAACTCCATATGTCTAGATGGGG + Intronic
1151650151 17:75462534-75462556 GAACTGTATATTTTTAAAAATGG - Intronic
1154314445 18:13293213-13293235 TAAATGAATATGTCTAGAAAAGG - Intronic
1155976307 18:32135160-32135182 GAACCAAACATGTTTAAAAATGG - Intronic
1156135751 18:34034969-34034991 GATCTAAAGATGTCTAAAGATGG + Intronic
1156919795 18:42507726-42507748 TAACTCAGTAGGTCTAAACAAGG + Intergenic
1157795049 18:50565686-50565708 CACCTAAATATGTCTAAACATGG - Intronic
1158371538 18:56811871-56811893 TAACTTTATATGTCTTAAAATGG + Intronic
1158897274 18:61926819-61926841 TAACTCAATATGTCTACAGATGG - Intergenic
1159234636 18:65655796-65655818 AAAATTTATATGTCTAAAAATGG + Intergenic
1160459835 18:79030463-79030485 GAAAACCATATGTCTAACAAGGG - Intergenic
1163053111 19:14699891-14699913 GAACTCCAGCTGTCTAAACAAGG + Intronic
1164027654 19:21367592-21367614 GAACTCCAGGTGTCTGAAAATGG + Intronic
1164395144 19:27856570-27856592 TATCTCAATATGTGCAAAAAAGG + Intergenic
1165237974 19:34438851-34438873 GAACTCAGGATGTTTAAATATGG + Intronic
1168569623 19:57455189-57455211 GAAATCAAAAAGTTTAAAAAGGG - Exonic
925475389 2:4207648-4207670 GAACAGAACATATCTAAAAATGG - Intergenic
926390674 2:12388900-12388922 AAACTCAATATGTTGAAAAGAGG - Intergenic
926918720 2:17918118-17918140 GAACTATAAATGTCAAAAAAGGG - Intronic
927362989 2:22258901-22258923 GAACTTAAAATGTCTAAAGTAGG - Intergenic
927959322 2:27230896-27230918 GGAATCAATATGCCTAAAACGGG - Intronic
928432366 2:31231561-31231583 GAAATCTATCTGTTTAAAAAAGG - Intronic
929709480 2:44251728-44251750 TATGTCATTATGTCTAAAAAAGG - Intergenic
929832949 2:45363592-45363614 CAACTTAAAATGTCTTAAAAAGG - Intergenic
930343780 2:50151678-50151700 GAACTGAGAATGACTAAAAATGG + Intronic
930416830 2:51099406-51099428 TAACTTAATATGTATAAAGAGGG - Intergenic
930698961 2:54440080-54440102 GAACTCAGTATGGCTAATCAAGG - Intergenic
931015174 2:57969328-57969350 AAAATAAATATGTTTAAAAATGG + Intronic
932383119 2:71304082-71304104 AAACTCTACATGTCTAAACAAGG + Intronic
933765664 2:85706907-85706929 CCACTCAACATGGCTAAAAAGGG - Intergenic
933883014 2:86689764-86689786 GAAAACAATATGAATAAAAATGG - Intronic
933911678 2:86946247-86946269 GAAAACAAAATGTCTAAAATGGG - Intronic
934011318 2:87823648-87823670 GAAAACAAAATGTCTAAAATGGG + Intronic
938453108 2:131441520-131441542 AAACTTAATATGTCCAAAATGGG - Intergenic
941383810 2:164828565-164828587 GCACTCACTGTGTATAAAAAAGG + Intronic
941721273 2:168815821-168815843 AAAGTCAATATGTCTAAAACAGG + Intronic
942161848 2:173197172-173197194 GAACTCCATTTGTATAAACAGGG + Intronic
942415527 2:175755009-175755031 TAACTCAAAATTTATAAAAATGG - Intergenic
942479452 2:176368390-176368412 CAACTCAATATGTCCAAAACTGG - Intergenic
943166969 2:184341382-184341404 GAACTCAATTAGTTTATAAAAGG + Intergenic
944167267 2:196736158-196736180 GCACTTAAAATGGCTAAAAAAGG - Intronic
945619984 2:212123713-212123735 GTACTAAATATGTCTAAAATTGG - Intronic
945799928 2:214415610-214415632 GAAATCAGTATGTAGAAAAAAGG + Intronic
947368709 2:229423308-229423330 AAACTCAGTATATCTTAAAATGG - Intronic
947545694 2:231008702-231008724 GACCTCAATATGCCAGAAAAAGG - Intronic
1169898488 20:10529671-10529693 GAATTCCATATCTCTAAGAAAGG + Intronic
1170205249 20:13791139-13791161 AAACTCAACATATCTAAAACAGG - Intronic
1171570344 20:26244147-26244169 GAAATAAAGATGTCAAAAAATGG + Intergenic
1172464798 20:35148136-35148158 AAACTCAATATCCCTAAATAAGG - Intergenic
1174960108 20:55146880-55146902 CAGCTGAATGTGTCTAAAAAGGG - Intergenic
1184570237 22:45318671-45318693 GAACTGTAAATGTCTAAATATGG + Intronic
950985690 3:17362954-17362976 GAAATGAATATGGCTATAAAAGG - Intronic
951495648 3:23322374-23322396 GAGTTCAAGATGTCTAAAACTGG + Intronic
952603415 3:35112829-35112851 AAAATCAATATGTTAAAAAAAGG - Intergenic
953274635 3:41482796-41482818 GAACTGAATTTTTTTAAAAAAGG - Intronic
953584822 3:44190033-44190055 GAACACTATATGTATAAAACAGG + Intergenic
954882845 3:53847067-53847089 GCAATCAATATGGCCAAAAAGGG - Intronic
955908246 3:63830508-63830530 AAACTCAGTAAGACTAAAAAGGG + Intronic
955982575 3:64541744-64541766 AAATTCTATATTTCTAAAAAGGG + Intronic
957109125 3:75930111-75930133 GAAATAAAGATGTCAAAAAATGG - Intronic
957191694 3:77018420-77018442 ACACTCAATATGTTTAAAAGAGG + Intronic
957276765 3:78100224-78100246 TAACTAAATATGTGTAAAAATGG + Intergenic
958174252 3:89974961-89974983 GAACTCAGTATATCCAAAATAGG + Intergenic
959558726 3:107754294-107754316 GAATTCAGCATGTCTAGAAAAGG + Intronic
962810523 3:138955479-138955501 GACCTCAATTAGTCTAGAAAGGG - Intergenic
964215867 3:154281324-154281346 GAATTAAATATGGTTAAAAATGG + Intronic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965991713 3:174827054-174827076 GAACTCAAGAAGTTTAAAACGGG - Intronic
966059875 3:175741818-175741840 GAACTCAAGATATCTAAGATAGG + Intronic
966161338 3:176972101-176972123 CAACTAAATATATCTAAACATGG + Intergenic
966742844 3:183250207-183250229 CAGCTTAATATGTCTAAAATGGG - Intronic
968198577 3:196731791-196731813 GAATTCAAAATGTTTTAAAAGGG - Intronic
968612154 4:1562202-1562224 GAAATCAATTTCTCTAATAATGG + Intergenic
970260075 4:14215336-14215358 GAACATAAAATGTCTTAAAAAGG + Intergenic
971327590 4:25656759-25656781 GAAATCAACATGTTTGAAAAAGG - Intronic
972876127 4:43362650-43362672 GAACTCAATGTTGTTAAAAATGG + Intergenic
974734749 4:65915129-65915151 AAATACAATATGTCTTAAAAAGG + Intergenic
974882004 4:67770902-67770924 ACACTAAATATTTCTAAAAATGG - Intergenic
975353368 4:73370460-73370482 GAAGTCAGTATGTCTGAAATAGG - Intergenic
975795062 4:77998266-77998288 GAACTGAACATTTTTAAAAAAGG + Intergenic
975970129 4:80023879-80023901 GAATTCCAGATGTCTAAAGATGG - Intronic
980254784 4:130364932-130364954 GAATAAAATATGTCTAAAAGAGG - Intergenic
980383708 4:132059715-132059737 TAATTTAATATGTATAAAAATGG + Intergenic
980476637 4:133326653-133326675 AAACTCAATATTACCAAAAATGG - Intergenic
982471308 4:155793703-155793725 ATACTCCATATGTCTAAAATAGG - Intronic
983002563 4:162435692-162435714 AAAATCAATATGTTAAAAAATGG - Intergenic
983511499 4:168613773-168613795 GAACTCGTTATGGATAAAAATGG + Intronic
983833504 4:172361128-172361150 CCACTCAATATATCTAAAATTGG + Intronic
983838981 4:172431621-172431643 GAATACCATATTTCTAAAAATGG + Intronic
983947324 4:173600715-173600737 GAATAAAATATGTTTAAAAATGG + Intergenic
984666595 4:182435742-182435764 GAACTACATATGCCTAAAAAGGG - Intronic
986513786 5:8539677-8539699 CAACTCACTGTGTCTAAATAAGG + Intergenic
988263071 5:28913898-28913920 GAACTGAAGATTTATAAAAATGG - Intergenic
989811838 5:45686605-45686627 GATCTAAAGGTGTCTAAAAAAGG - Intronic
990189838 5:53247483-53247505 CAATTAAATATGTCTAACAAAGG + Intergenic
990922983 5:60988323-60988345 GAACCCAATATTTTTTAAAATGG + Intronic
990956746 5:61348357-61348379 GAACTCTCTATATCTAAATACGG - Intronic
994489016 5:100417756-100417778 GAATTGGGTATGTCTAAAAAAGG - Intergenic
995253073 5:110016595-110016617 GAACTCAACATGTCCTAAACTGG + Intergenic
995265969 5:110161082-110161104 AAACTCAAGTTGTCTAAAATTGG + Intergenic
995587959 5:113668872-113668894 CAACTCAAGATGGATAAAAAAGG + Intergenic
996948029 5:129094067-129094089 GAACACAATATCTCTAGGAATGG - Intergenic
1000567943 5:162874436-162874458 GAACTCTTAATGTCTCAAAATGG - Intergenic
1005220118 6:23576704-23576726 GAAATCAATCTGTCTCACAATGG + Intergenic
1006202451 6:32307123-32307145 GAGCTCAAGATGATTAAAAAAGG - Intronic
1010702084 6:79062924-79062946 GAACACAAAGTGTCCAAAAAGGG - Intronic
1010742748 6:79527322-79527344 GAAGTTAATATGGCTAAAATGGG + Intronic
1011293087 6:85797619-85797641 AAACTCAAGATGTCTGAAAATGG - Intergenic
1011452126 6:87504440-87504462 GAAATCAACATATCTAAATAAGG - Intronic
1011595108 6:89008609-89008631 TTACCCTATATGTCTAAAAAGGG - Intergenic
1012109259 6:95205536-95205558 AAACTTAAAATGTCCAAAAAAGG - Intergenic
1012140559 6:95621878-95621900 GAACTCTATATTTTTAAAATTGG - Intergenic
1013125963 6:107184384-107184406 GGACTCAATATGCAGAAAAATGG + Intronic
1015066255 6:129032640-129032662 AAACTCATTATGTAAAAAAAGGG + Intronic
1018141157 6:160838323-160838345 GAAGTGAATATTTCAAAAAATGG + Intergenic
1018766239 6:166935277-166935299 AAACTCAATATATCAAAAATAGG - Intronic
1020417366 7:7961278-7961300 GAAGTGAATGTGTCTAAAATGGG - Intronic
1020532217 7:9353281-9353303 GAACTGAGGATGTATAAAAATGG + Intergenic
1022047755 7:26636372-26636394 GAACTCAAGATCTTTAAAGAGGG + Intergenic
1022299261 7:29087548-29087570 GAACAAAATATTTCAAAAAAAGG + Intronic
1023263463 7:38381078-38381100 GAACTCAATGAGTTTAAAGATGG - Intergenic
1024823367 7:53360592-53360614 AAACTCAAAATGGCTAAAATTGG - Intergenic
1025564127 7:62410138-62410160 GAACTCACAATGTCTAATTAAGG - Intergenic
1028292465 7:89082807-89082829 GATCTAAATAAGTGTAAAAATGG + Intronic
1028520932 7:91729685-91729707 GCACTCAATATAAGTAAAAATGG + Intronic
1030419951 7:109296539-109296561 GAATTCAATATATCTAAAACGGG - Intergenic
1030432950 7:109475453-109475475 AATCTCAAAATGGCTAAAAATGG + Intergenic
1031440078 7:121783515-121783537 TAACTCAATAGGCCTCAAAATGG - Intergenic
1031603809 7:123746199-123746221 GAGCTTACTAGGTCTAAAAAGGG - Intronic
1032913652 7:136462527-136462549 GAACTCATCATGTCCCAAAAGGG + Intergenic
1035037490 7:155904698-155904720 AAACACAATAAGTCCAAAAAAGG - Intergenic
1035786126 8:2262651-2262673 GAAAACATTTTGTCTAAAAAGGG + Intergenic
1035806681 8:2459065-2459087 GAAAACATTTTGTCTAAAAAGGG - Intergenic
1036075095 8:5489859-5489881 TAATGCAATATGTCTAAGAATGG - Intergenic
1037112214 8:15177222-15177244 GAACACAATATGACAAATAAAGG + Intronic
1038191160 8:25322440-25322462 GAACTCAGTATGGCTAAAGCAGG + Intronic
1038919055 8:32062154-32062176 GAACTCAAAATATCTCAGAAAGG - Intronic
1039689404 8:39848030-39848052 GAAGACTATATGTCTAAGAAAGG - Intergenic
1039784662 8:40823257-40823279 GAACACAAAAAGTCTAATAAAGG + Intronic
1041416270 8:57612434-57612456 GAACTCAATATGACAAAAGCTGG + Intergenic
1042958794 8:74280379-74280401 GAACTCATTATGTGCAGAAATGG + Intronic
1043308381 8:78825845-78825867 AAATTGAATATGTCTAAAAGGGG - Intergenic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1044299115 8:90563373-90563395 GAACATAATAGTTCTAAAAATGG - Intergenic
1044624070 8:94218858-94218880 GAACCCTGTTTGTCTAAAAACGG + Intergenic
1045263278 8:100596199-100596221 GCACTCAATAAATCTAATAAGGG + Intronic
1046297571 8:112241672-112241694 GAGTTCATTATTTCTAAAAATGG - Intronic
1047055812 8:121164060-121164082 GTACTCAATATGTGTGTAAAAGG + Intergenic
1048102585 8:131370007-131370029 CATCTCAATATCTCTCAAAAAGG + Intergenic
1050110013 9:2205385-2205407 TAACTCAAAATGAATAAAAATGG + Intergenic
1050192921 9:3047525-3047547 GAGCTCAAAATATCTACAAAAGG + Intergenic
1050883504 9:10735245-10735267 GAAAACAAAATGTATAAAAAAGG - Intergenic
1050957593 9:11684681-11684703 GGACTGTAAATGTCTAAAAAAGG - Intergenic
1051397725 9:16643902-16643924 GAACTCAAGATTTTTAAAACTGG - Intronic
1052455610 9:28693217-28693239 TGTCTCAATATGTTTAAAAATGG - Intergenic
1052481924 9:29040922-29040944 GAACTCAGTATGTATATTAATGG - Intergenic
1052585590 9:30424349-30424371 TAACTTCATATGACTAAAAAAGG + Intergenic
1054785991 9:69210720-69210742 GAACTCAAAATACCTGAAAAAGG - Intronic
1055620765 9:78122671-78122693 AAACTTAACATGTCCAAAAATGG + Intergenic
1185964368 X:4583771-4583793 GAACTCAAAATATCTAAGACAGG - Intergenic
1186038606 X:5451559-5451581 GAACTCAAAATGAATTAAAAGGG - Intergenic
1188096510 X:26030019-26030041 TAACTCCATATTTTTAAAAATGG + Intergenic
1189507843 X:41630776-41630798 GAACTCAAAAGCCCTAAAAAGGG + Intronic
1190658107 X:52629940-52629962 GAATTCACAACGTCTAAAAAAGG - Intergenic
1192982204 X:76357138-76357160 GACATCAAAATGTCTGAAAAAGG + Intergenic
1193511979 X:82413510-82413532 GAACACAGCATGTCCAAAAATGG - Intergenic
1194011608 X:88569056-88569078 GAACCCAAAATGACTAAAGATGG - Intergenic
1197932275 X:131708294-131708316 TAACTCAAAATGTTTTAAAACGG + Intergenic
1198668422 X:139050777-139050799 GAATTAACTATGACTAAAAATGG - Intronic
1200106623 X:153717237-153717259 GAGCTCTATATGTCTAACAGCGG - Intronic
1202391756 Y:24378049-24378071 GAATACTATATGGCTAAAAAAGG + Intergenic
1202479029 Y:25292068-25292090 GAATACTATATGGCTAAAAAAGG - Intergenic