ID: 903744631

View in Genome Browser
Species Human (GRCh38)
Location 1:25578294-25578316
Sequence CTCTCTGGAGGGCTGCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903744631_903744638 -3 Left 903744631 1:25578294-25578316 CCCTCAAGCAGCCCTCCAGAGAG No data
Right 903744638 1:25578314-25578336 GAGGGTTTGTCAGACAACTCCGG No data
903744631_903744639 2 Left 903744631 1:25578294-25578316 CCCTCAAGCAGCCCTCCAGAGAG No data
Right 903744639 1:25578319-25578341 TTTGTCAGACAACTCCGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903744631 Original CRISPR CTCTCTGGAGGGCTGCTTGA GGG (reversed) Intergenic
No off target data available for this crispr