ID: 903745208

View in Genome Browser
Species Human (GRCh38)
Location 1:25582023-25582045
Sequence TGGGAAGCCCAGGCCTGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903745208_903745218 2 Left 903745208 1:25582023-25582045 CCAGCGCAGGCCTGGGCTTCCCA No data
Right 903745218 1:25582048-25582070 GGTGGAACTTATCTGGGTTCTGG No data
903745208_903745216 -4 Left 903745208 1:25582023-25582045 CCAGCGCAGGCCTGGGCTTCCCA No data
Right 903745216 1:25582042-25582064 CCCAGGGGTGGAACTTATCTGGG No data
903745208_903745214 -5 Left 903745208 1:25582023-25582045 CCAGCGCAGGCCTGGGCTTCCCA No data
Right 903745214 1:25582041-25582063 TCCCAGGGGTGGAACTTATCTGG No data
903745208_903745219 20 Left 903745208 1:25582023-25582045 CCAGCGCAGGCCTGGGCTTCCCA No data
Right 903745219 1:25582066-25582088 TCTGGTCCTGATCTCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903745208 Original CRISPR TGGGAAGCCCAGGCCTGCGC TGG (reversed) Intergenic
No off target data available for this crispr