ID: 903753352

View in Genome Browser
Species Human (GRCh38)
Location 1:25644003-25644025
Sequence GTTCCACTTCAGCTTTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903753352 Original CRISPR GTTCCACTTCAGCTTTTTCA GGG Intronic
901531392 1:9855341-9855363 GTCCAACTTCTTCTTTTTCAAGG - Intronic
902797910 1:18811278-18811300 GTTCCACTTCTGCCATTTCCAGG - Intergenic
903753352 1:25644003-25644025 GTTCCACTTCAGCTTTTTCAGGG + Intronic
906342401 1:44992296-44992318 GTTGAACTACTGCTTTTTCATGG - Intergenic
906542020 1:46594280-46594302 TTTCTATTTCTGCTTTTTCAAGG - Exonic
908172713 1:61523277-61523299 CTTCCATTTGAGCTTTTGCAGGG - Intergenic
908589070 1:65609433-65609455 ATTCCACATCAGCTTTGTGACGG + Intronic
913325534 1:117624906-117624928 TTTCCTCATCAGCTCTTTCATGG + Exonic
914281323 1:146175918-146175940 GTACCACTTCAGCTTCTTTTTGG - Intronic
914542368 1:148626853-148626875 GTACCACTTCAGCTTCTTTTTGG - Intronic
914624267 1:149444392-149444414 GTACCACTTCAGCTTCTTTTTGG + Intergenic
914913007 1:151801867-151801889 GTACCACCTCAGCTTCCTCAGGG - Exonic
915317660 1:155038416-155038438 CTTACACTTCAGTTTTTACAAGG - Intronic
916321798 1:163512830-163512852 GTACCACTTCTGATTATTCAGGG - Intergenic
917783504 1:178426364-178426386 CTCCCACTTCAGTGTTTTCAAGG - Intronic
918036864 1:180882171-180882193 GTTCCATTTCAGGTGTTTAACGG + Intronic
919563376 1:199152810-199152832 TTTCCTCTTCAGTTTTTCCAGGG - Intergenic
919653503 1:200174633-200174655 GTTTCAGTTCAGCTTTACCATGG - Exonic
922407595 1:225332173-225332195 GTTACACCTCAGCTATCTCAAGG + Intronic
923955809 1:239018990-239019012 ATTCCACTTCATCTTTTGCACGG + Intergenic
1063566494 10:7175734-7175756 GTTCCTCTTCTTCTTTTCCAAGG + Intronic
1065312336 10:24428398-24428420 GTTGACCCTCAGCTTTTTCAGGG - Intronic
1065662532 10:28020837-28020859 GTTGCACTTCAGCTTATAAATGG - Intergenic
1066479248 10:35779503-35779525 TCTCCACTTCAGCTCTTTCATGG + Intergenic
1068353503 10:55880921-55880943 GCTCCACTGCAGCTGTTCCAAGG - Intergenic
1069055229 10:63838021-63838043 GTTCCATTGCAGCATTTTCAGGG - Intergenic
1069866483 10:71506851-71506873 GGTCCTTTTCAGCTTCTTCATGG - Intronic
1071697612 10:87893679-87893701 GTTCAACTTCTAATTTTTCATGG - Intronic
1072401788 10:95110558-95110580 GGTCCACTCCAGATTTTTCCTGG + Intergenic
1072522972 10:96245672-96245694 GTTTTACTTAAGCTATTTCATGG - Intronic
1073090942 10:100939197-100939219 GTTACACTTCAGATATTTGAAGG - Intronic
1073765141 10:106674013-106674035 CTACCACTTCTGCTTTTTAATGG - Intronic
1074297208 10:112201346-112201368 CTTACACTTCTGCTCTTTCATGG + Intronic
1075396728 10:122133068-122133090 GTGCTACTTCTCCTTTTTCAGGG + Intronic
1077556381 11:3228028-3228050 CTACCACTTCAGCTTCCTCATGG - Exonic
1077985935 11:7351130-7351152 ATACCACTTCATCTTTTTCAAGG - Intronic
1078372817 11:10764571-10764593 GTTCCGCTTCTGCTTTTGCACGG - Exonic
1079816444 11:25065657-25065679 GTTCCATTTCAGGTTTTGCCAGG + Intronic
1079943172 11:26707897-26707919 GATGCACTTCAGATTTTGCAAGG - Intronic
1083090884 11:60199673-60199695 GTTCAACTACAGATTTTTAATGG + Intergenic
1084379346 11:68801193-68801215 GTTCCACTTCAGCTCATTCAGGG - Intronic
1084882797 11:72183764-72183786 GTTCCAGGTTAGCTTTTTCTAGG - Intergenic
1085636347 11:78162364-78162386 GTCCCACTTGAGCTTTTTGGTGG + Intergenic
1088108316 11:106230004-106230026 GTTCCACTTGAACTTTTAAAAGG - Intergenic
1088318085 11:108527595-108527617 GTTCTGTTTCTGCTTTTTCATGG - Intronic
1088526125 11:110757040-110757062 GTTTTACTTCTGCCTTTTCAAGG - Intergenic
1089047633 11:115517117-115517139 TTTTCACTTGAGCTTGTTCATGG - Intergenic
1090843588 11:130513339-130513361 CTTCCCCTTCAGCCTCTTCATGG + Intergenic
1091468173 12:703841-703863 GTTCTTCTTCTTCTTTTTCATGG - Intergenic
1092902381 12:13071938-13071960 GTTACACTGCAGTATTTTCATGG + Intronic
1097034024 12:56110405-56110427 CCTCAAATTCAGCTTTTTCATGG - Exonic
1097073305 12:56372994-56373016 GTTCAACTTCATCTTTTTGCAGG - Intergenic
1098590956 12:72211363-72211385 CAGCCACTTCAGCTCTTTCATGG - Intronic
1102062757 12:109946448-109946470 GTTACATTTAAACTTTTTCATGG - Intronic
1102621212 12:114196274-114196296 GATTCACTGCAGCCTTTTCAAGG + Intergenic
1104098242 12:125581055-125581077 TTCCTCCTTCAGCTTTTTCATGG - Intronic
1104240833 12:126987687-126987709 ATTCTGCTTCAGATTTTTCAAGG + Intergenic
1104433824 12:128739796-128739818 TTTCCACCTGAGCTATTTCATGG + Intergenic
1104459206 12:128940784-128940806 ATTCCACCTCAACTTTTTAAAGG - Intronic
1108436923 13:50410098-50410120 TTTCCACTTCGCCTTTTCCAGGG + Intronic
1108520118 13:51239068-51239090 GTACCACTTCAGCTTTTCAAGGG - Intronic
1108528571 13:51306781-51306803 GTTCCACTTCATTATTTTCCTGG - Intergenic
1108682817 13:52794023-52794045 TTTCCACTGCTGATTTTTCAGGG + Intergenic
1109269974 13:60244734-60244756 ATTTCCCTTCATCTTTTTCATGG + Intergenic
1110109260 13:71723022-71723044 GTTTCTTTTCATCTTTTTCATGG + Intronic
1111687478 13:91519066-91519088 ATTCCACTTTAGCTAATTCACGG - Intronic
1112875012 13:104026409-104026431 GTTCATCTTCTCCTTTTTCATGG + Intergenic
1114166988 14:20229701-20229723 GTTCCACTTCTTCTTTTCCCTGG + Intergenic
1115111990 14:29835336-29835358 GTTCAACTTTTGCTTTCTCATGG + Intronic
1115335779 14:32243344-32243366 GTTCCAGTTCTGATGTTTCAGGG + Intergenic
1116052056 14:39816036-39816058 GTTCCATTTTGTCTTTTTCACGG + Intergenic
1117333718 14:54738597-54738619 TTTCTACTTCAGAGTTTTCAGGG + Intronic
1117880959 14:60313138-60313160 TTCCCTCTTCAGCTTTCTCAGGG + Intergenic
1119968781 14:78946328-78946350 GTTCCTCTTCACATTCTTCATGG - Intronic
1121226702 14:92326518-92326540 GTTCTTCTTCAGATTTTTCTTGG + Intronic
1124129589 15:26971915-26971937 TTCCCACCTCAGCTGTTTCAGGG + Intronic
1126759824 15:51959608-51959630 TTTCAATTTCAGCCTTTTCAGGG + Intronic
1128171768 15:65519674-65519696 GTTCCTCTACAGCTTTCTCAGGG - Intergenic
1129552825 15:76472103-76472125 CATCCCCTTCAGCTTTTTCTTGG - Intronic
1131134128 15:89920364-89920386 TTTCCAGTTCAGGCTTTTCAGGG - Intergenic
1132533422 16:465344-465366 ATTCCACTTCTTGTTTTTCATGG - Intronic
1136174109 16:28505879-28505901 GCTCCCCTTCACCTTTATCAGGG - Intronic
1136297526 16:29312155-29312177 GTTCCACATCAGTTCTTTCTTGG + Intergenic
1136989676 16:35144409-35144431 GTTCCACTTTAGGTTTGTGAAGG + Intergenic
1147759074 17:42785870-42785892 TTTCCACTTCAGCATGTTCTCGG + Intronic
1150327629 17:64269449-64269471 CTTCCACTTCTGCTATTTAAGGG - Intergenic
1152827764 17:82478508-82478530 GTTCCCCTTCACCTTTTTGGGGG + Intronic
1153746175 18:8181874-8181896 GTTCCACTTTTTCTTTTTTAAGG - Intronic
1155058999 18:22211867-22211889 ATTCAACTTCTGCTTTTTGAGGG + Intergenic
1155593286 18:27452999-27453021 CATCAAATTCAGCTTTTTCATGG + Intergenic
1159066432 18:63573027-63573049 GTCCCAGTTCAGATATTTCATGG - Intergenic
1159555082 18:69937416-69937438 GTTCAAATTCCACTTTTTCAGGG + Intronic
1163952771 19:20605970-20605992 GTTCCAGCTTAGCATTTTCAGGG + Intronic
1164707165 19:30328388-30328410 GTTCCTCTTCTGCCTTGTCAGGG - Intronic
1165601768 19:37060063-37060085 GTTGCACTTCGGGTTTTTGAAGG + Intronic
927013931 2:18935892-18935914 GCTTCACTTCAGATTTTTAAAGG + Intergenic
928410438 2:31050101-31050123 GGTTCACTTCTGCTTTTTCTTGG - Intronic
928656505 2:33457469-33457491 TTTCCATTACATCTTTTTCATGG + Intronic
930207692 2:48604242-48604264 GTTCCCCTTCAGCTCTTTTGAGG + Intronic
931744239 2:65278120-65278142 CTTCCACTTAAGTTTCTTCATGG - Intergenic
934021290 2:87956306-87956328 GTTCCACTTCTGGTGTTACAAGG + Intergenic
937973240 2:127565867-127565889 GTTCCAATGCAGATTTTTCCAGG + Intronic
938618213 2:133021398-133021420 CTTCCACTTCAAATTTTTCCTGG + Intronic
940065140 2:149619220-149619242 TTTCTACTTCAGCTTTTTCTAGG - Intergenic
940572128 2:155450317-155450339 GTTCCATTTAAGCTTTATCTTGG - Intergenic
941352849 2:164457359-164457381 GGTCCACTTGTGCTGTTTCATGG - Intergenic
941909327 2:170747872-170747894 GTTTCACTTCAGATTCTTCCTGG - Intergenic
942822599 2:180133452-180133474 CTTCCATCTCAGCTTTTGCATGG - Intergenic
943417178 2:187622460-187622482 TTTATACTTCAGCTTTTTAATGG + Intergenic
943710389 2:191087550-191087572 GTTTCATTTCAGATTTTTAAAGG - Intronic
947441457 2:230125380-230125402 GCTCCACTTCATCTTTTCCCAGG - Intergenic
947808252 2:232983141-232983163 TTTCCACTTAAGATTTTTCCAGG - Intronic
1169949065 20:11022664-11022686 GATCAACATAAGCTTTTTCAAGG - Intergenic
1170072136 20:12380696-12380718 CCTCAAATTCAGCTTTTTCATGG - Intergenic
1170541318 20:17391297-17391319 GCTCCACTTCTGCTTTTCAAGGG - Intronic
1170655368 20:18281932-18281954 GTTCCATTTCACCTTGTTCCTGG - Intergenic
1173302857 20:41819099-41819121 CTTCCACGTCAGCTGTTTCACGG + Intergenic
1175215357 20:57389512-57389534 TTTCCCCTTCAGTTTTTCCAAGG - Intergenic
1176074326 20:63241579-63241601 GTTCCATTTCAGGTTCTCCAAGG - Intronic
1177418245 21:20822608-20822630 TGTCCACTTGAGCTTTTACAGGG - Intergenic
1178201328 21:30409333-30409355 GTGTCACTACAGATTTTTCATGG - Intronic
1178470363 21:32886943-32886965 GTTCACCATCAGCTTTTTCGTGG + Intergenic
1178580971 21:33838367-33838389 GTTGCACTTCAGTATTTTCACGG + Intronic
1180363478 22:11919899-11919921 GTTCCACATGAGTTTTTCCAGGG - Intergenic
1183985879 22:41570194-41570216 GCCCCACTTCAGCCTTTTCAGGG + Intronic
1184310121 22:43635847-43635869 ATTCCACTTCAGTATTTGCAAGG - Intronic
951304973 3:21048398-21048420 CTTTCACTGCAGCTTTCTCAGGG - Intergenic
951547751 3:23845817-23845839 GTTCCAATACAGCTTTATTACGG + Intronic
958261794 3:91390635-91390657 GTTCCTCTTGAGTGTTTTCATGG - Intergenic
958737042 3:98021192-98021214 GTCCCACTGCACCTTATTCATGG + Intronic
960034393 3:113087890-113087912 GTTCCCCTTCAGCTACATCAGGG + Intergenic
964450706 3:156810075-156810097 TGTCAAATTCAGCTTTTTCATGG + Intergenic
966352503 3:179046205-179046227 GTACCTCTTCTGCCTTTTCATGG - Intronic
970413429 4:15833284-15833306 GTATCACTTCTGGTTTTTCAGGG + Intronic
970987384 4:22174418-22174440 GTTCCAATTCATCTTTCTCGTGG - Intergenic
971636066 4:29059656-29059678 TTTCAGCTTCAGCTTTTTAAAGG + Intergenic
973324434 4:48844236-48844258 GCTCTACTTCAGCTATTTAATGG - Intronic
973392325 4:49567095-49567117 ATTCCACATCAGTTTTTCCAGGG - Intergenic
973529279 4:51818994-51819016 GTTACTCCTCAGCTGTTTCAGGG - Intergenic
973645517 4:52947498-52947520 GTTCTTCTTCAAATTTTTCATGG - Intronic
973902066 4:55485575-55485597 ATTCCACTTCAGCTTGTGTAGGG - Intronic
974351976 4:60760208-60760230 GTTGCACTTCACCTTCTTGAGGG - Intergenic
974924835 4:68284464-68284486 TTACCACTTCAGATTTTTCTTGG - Intergenic
975825892 4:78319200-78319222 CTTCCACTCCACCTTTTCCAAGG + Intronic
976045708 4:80944476-80944498 GTTCTAGTTCAGGTTCTTCAGGG - Intronic
976319477 4:83696586-83696608 GTTCCACTTGTTCCTTTTCACGG - Intergenic
978539482 4:109801914-109801936 CTTCCACTTAAGGTTTTGCAAGG - Exonic
979025061 4:115560054-115560076 AGTCCACTTCTGTTTTTTCAAGG + Intergenic
981036822 4:140178674-140178696 GTTCCACTTCAGAATTTTCTTGG - Intergenic
982062582 4:151619597-151619619 GTTACATTTCTGCTTTATCATGG + Intronic
982505827 4:156216761-156216783 TTTCCACTTCTGCAATTTCAAGG + Intergenic
984000536 4:174236110-174236132 GTTGTACTACAGATTTTTCAAGG - Intergenic
987689052 5:21243794-21243816 ATTCAACTTCAACTTTTTCAAGG + Intergenic
992024949 5:72661005-72661027 GTTTTATTTCAGCTTTTTCTGGG - Intergenic
993316286 5:86410424-86410446 GTTCAAATTCATGTTTTTCAAGG + Intergenic
993726859 5:91379515-91379537 GTTAGACTTCATTTTTTTCAAGG - Intronic
996291918 5:121861324-121861346 TTGTCAGTTCAGCTTTTTCACGG - Intergenic
996749283 5:126872825-126872847 GATCCACTTTAGCATGTTCAGGG - Intronic
998423106 5:142005384-142005406 TTTCCTCCTCAGCTTTTTGAGGG - Intronic
999321755 5:150619584-150619606 GACCCACTTCAGCGTTTCCATGG - Intronic
1001341192 5:170847222-170847244 CTTCCACTTCAGATGTTTTATGG - Intergenic
1001778932 5:174350926-174350948 GCACCACCTCAGCTTTCTCAGGG + Intergenic
1003735230 6:8870626-8870648 TTTCTAATTCAGCTTTTTCACGG + Intergenic
1003752818 6:9080421-9080443 GTTCGATTTCAACTCTTTCATGG + Intergenic
1004286798 6:14328967-14328989 TTTTGACTTCAGCTTCTTCATGG + Intergenic
1005314849 6:24595037-24595059 TTTTCACCTGAGCTTTTTCATGG + Intronic
1005947845 6:30607812-30607834 GTGCCACTTCTGCTCTCTCATGG - Intronic
1009216340 6:60924910-60924932 GTGCCATTGCAGCTTTTTCTTGG + Intergenic
1012000081 6:93644091-93644113 GTACCAGCTCAGCTTCTTCAAGG - Intergenic
1012237526 6:96836844-96836866 GCTCCACTTGAACTTTTACACGG - Intronic
1013612176 6:111805840-111805862 TTTCCACTTCAACTTTTACACGG - Intronic
1014627351 6:123743885-123743907 GTTCCACTTCTGCCTTTTGATGG - Intergenic
1014799172 6:125758987-125759009 GTTCCACTTCAGTCTTCTGAAGG + Intronic
1015556639 6:134469122-134469144 ATTCCAGTTTAGCTTTTTAAGGG - Intergenic
1017021636 6:150144020-150144042 GTTCCATCTCAGGATTTTCACGG - Intronic
1017869157 6:158471610-158471632 GTTCTACTTCAGCTCTTTCCTGG - Intronic
1021541564 7:21764913-21764935 CTTCCGCTTCAGATTTTTAAAGG - Intronic
1022206494 7:28169270-28169292 GCTCCACTTCAGCACTTTCAGGG - Intronic
1024105640 7:46082267-46082289 GTTCAACTTCTACTTTTTCCTGG - Intergenic
1024731101 7:52254748-52254770 ACTCGACTTCAGCTTTTTGAGGG - Intergenic
1025173863 7:56786561-56786583 TTTCCACTTAGCCTTTTTCATGG - Intergenic
1025698238 7:63791396-63791418 TTTCCACTTAGCCTTTTTCATGG + Intergenic
1025829967 7:65039852-65039874 TTTCCACTTAGCCTTTTTCATGG + Intergenic
1025920886 7:65911920-65911942 GTTTCACTGCATCTTTTTAAAGG + Intronic
1027858793 7:83548293-83548315 GCTCTACTTCAAGTTTTTCATGG + Intronic
1031122641 7:117738983-117739005 TTTCCACTTCATCTTTATCTTGG + Intronic
1031138668 7:117916510-117916532 GTACCACTTCCTCTTTTTCAGGG + Intergenic
1033272908 7:139948622-139948644 GTTACATTTCATCTTCTTCATGG - Intronic
1034524412 7:151648035-151648057 GTTAAACTTCAGCTATTACAAGG + Intronic
1034911292 7:155001233-155001255 GTTCCAGTTCAACTTGTTCCAGG + Intronic
1035893970 8:3376524-3376546 GTTCAACTGCACATTTTTCACGG - Intronic
1038245059 8:25847690-25847712 GTTCTAGTTCAGCTCTTTCCGGG - Intronic
1040945062 8:52875457-52875479 GTTACACTTCAGTTTCTTTAGGG + Intergenic
1043210450 8:77507697-77507719 CTTCCACTTGAGAATTTTCAAGG + Intergenic
1044241455 8:89893095-89893117 TTACCACTGCAGATTTTTCAGGG - Intergenic
1044300911 8:90581872-90581894 GTTCCTATTCAGCCTGTTCAGGG - Intergenic
1044936963 8:97302672-97302694 TTTCCACTTCATCATTTGCAAGG + Intergenic
1045551148 8:103173805-103173827 ATTCCAATTCAACTTTGTCAAGG - Intronic
1047648098 8:126890049-126890071 GTTCCACTTTTGGTTTTTTAAGG - Intergenic
1051557846 9:18404859-18404881 ATTCCACTTCCCCTTTTTCCAGG + Intergenic
1055007864 9:71529050-71529072 GTCCCACTTCAGCTTCTAGATGG - Intergenic
1056766952 9:89450194-89450216 CCTCAAATTCAGCTTTTTCATGG - Intronic
1058501864 9:105627642-105627664 GTCCCACTTCTGCTCATTCAAGG + Intronic
1060425692 9:123503629-123503651 GTTGCACTTGAAGTTTTTCAGGG - Intronic
1061598279 9:131646934-131646956 TTTCCCCTTCAGCTCTTCCAGGG - Intronic
1062678142 9:137760468-137760490 GTTTCACTTCATCGTTTTCCTGG + Intronic
1185745796 X:2572491-2572513 CATCCAATTCAGCTTTTGCAAGG + Intergenic
1186669506 X:11755754-11755776 ATTCCACACCAGCTTTATCAGGG + Intergenic
1188154843 X:26728721-26728743 TTTCCATTTCAGGTTTTTCTTGG - Intergenic
1189917708 X:45873171-45873193 ATTCTCCTTCAGCTTTGTCAGGG + Intergenic
1192796714 X:74429532-74429554 GTTGCTCTTCTGCTTTTACATGG + Intronic
1194235202 X:91374379-91374401 GTTTCACCTCATCTCTTTCAAGG - Intergenic
1194805004 X:98316378-98316400 GTTACATTTCAGCGGTTTCAAGG + Intergenic
1195644572 X:107214387-107214409 GTTCCACTTCACTATATTCAAGG - Intronic
1198619281 X:138488637-138488659 TTCCAGCTTCAGCTTTTTCATGG + Intergenic
1199123234 X:144082815-144082837 GTTCCACTTCTGGTGTTACAAGG - Intergenic
1202231694 Y:22665240-22665262 TTTCCACTGCAGCTTTTTGAGGG - Intergenic
1202311464 Y:23530925-23530947 TTTCCACTGCAGCTTTTTGAGGG + Intergenic
1202559338 Y:26139669-26139691 TTTCCACTGCAGCTTTTTGAGGG - Intergenic