ID: 903757017

View in Genome Browser
Species Human (GRCh38)
Location 1:25669439-25669461
Sequence CTGGCAAAAGGGCTGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903757017 Original CRISPR CTGGCAAAAGGGCTGGTACA TGG Intronic
900117631 1:1035207-1035229 CTGGGCAAAGGGATGGGACAGGG + Intronic
901830367 1:11888448-11888470 GTGGAGAAAGGGCTGGTGCAAGG - Intergenic
902610735 1:17595767-17595789 CTGGCACAGGGGCTGGCACGTGG - Intronic
902951213 1:19884022-19884044 CTGGCAAAGTGCTTGGTACATGG + Intronic
903165615 1:21518378-21518400 CTGAAAAATGGGCTGGTATAAGG - Intronic
903274165 1:22210284-22210306 CCAGCAAAAGGGCTGGCACTGGG - Intergenic
903355692 1:22746081-22746103 CTGGCAAAATGCCTGGCCCAGGG - Intronic
903703978 1:25271609-25271631 CTGGCAGAAGGTCTGGTACATGG - Intronic
903723257 1:25421707-25421729 CTGGCAGAAGGTCTGGTACATGG + Intronic
903757017 1:25669439-25669461 CTGGCAAAAGGGCTGGTACATGG + Intronic
904422232 1:30401727-30401749 CAGGCAAAAGGGCTTGTGCAGGG + Intergenic
904476620 1:30769203-30769225 CCGGCAGAAGGGCTGGACCAGGG + Intergenic
904579204 1:31527944-31527966 CAGGCAAGAGGGCTTGTGCAGGG + Intergenic
904951004 1:34238746-34238768 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
906816817 1:48887881-48887903 CTGGCAAAGGGCCTGGCACAGGG + Intronic
907719118 1:56954901-56954923 CTGACAAAAGGTCTGGCACTTGG - Intronic
907763725 1:57387873-57387895 CTGGTGGAAGGGCTGGTACCAGG - Intronic
908515683 1:64890494-64890516 CTGCCTAGAGGGTTGGTACAAGG + Intronic
909382203 1:75011512-75011534 CTGGCAAAGTGCCTTGTACATGG - Intergenic
910337956 1:86155526-86155548 CTGGGAAAAGGGCTCGGACCAGG - Intronic
914916213 1:151820863-151820885 CTGGCAAAAAGGCAGGAATAGGG - Intronic
917035317 1:170742173-170742195 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
917035614 1:170744395-170744417 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
917652544 1:177093101-177093123 CTAGAAAAAAGTCTGGTACATGG + Intronic
919392806 1:197009062-197009084 GTGGCAAAAGAGCATGTACATGG + Exonic
920037066 1:203073108-203073130 CTGGCACAATGCCTGGCACAGGG - Intronic
920845094 1:209587071-209587093 GTGGCAGAAGGGCTGGGAAATGG + Intronic
921949060 1:220910143-220910165 CTGGCACAGAGGCTGGTATATGG - Intergenic
923062167 1:230485741-230485763 CAGGAAAACGGGCTGGTACCTGG + Intergenic
1063119832 10:3097551-3097573 CTGGCTCACAGGCTGGTACAGGG - Intronic
1063186745 10:3658797-3658819 ATGGCAAAAGAGCTGGTAAAGGG - Intergenic
1063207317 10:3845675-3845697 CTAGCAAAATGCCTGGCACATGG - Intergenic
1063741760 10:8830254-8830276 CTGGCAAGAGGGCAGTTATATGG + Intergenic
1065398551 10:25269084-25269106 CTGGCAAAGAAGCTGGCACATGG + Intronic
1067744142 10:48922265-48922287 CTGGAAAAAGGGATGATTCAAGG - Intronic
1067782781 10:49221162-49221184 CTGGCAGAAAGACTGGTACATGG + Intergenic
1070662673 10:78318829-78318851 CTGGCAAGAGAGCTTGTGCAGGG + Intergenic
1070765659 10:79054694-79054716 CTGGGATAAGGGCTGATAGAAGG + Intergenic
1070843556 10:79504605-79504627 CTTGCAAAATAGCTGGTAGATGG - Intergenic
1070930111 10:80254995-80255017 CTTGCAAAATAGCTGGTAGATGG + Intergenic
1071580967 10:86769936-86769958 CTGGCAAGAAGGCTGGTGCCTGG - Intronic
1072450404 10:95535003-95535025 CTAGCACAAGTCCTGGTACAAGG + Intronic
1072741822 10:97914402-97914424 CTGGCACATGGCCTGGCACACGG - Intronic
1073219412 10:101857491-101857513 CTGGCAAATGGACTGCTAGAGGG + Intronic
1074285098 10:112090582-112090604 CTGGCTAGAGGGATGGTCCAGGG - Intergenic
1074441579 10:113481731-113481753 CTGGGCAAAGGGCTAGAACAGGG - Intergenic
1074891519 10:117740188-117740210 CTTTCAAAAGGGCTTGGACAGGG - Intergenic
1075280348 10:121133497-121133519 CTGCCAGAAGGGCAGGCACATGG - Intergenic
1075672418 10:124271563-124271585 CAGGCAAGAGGGCATGTACAGGG - Intergenic
1075822676 10:125328220-125328242 CAGGCAAGAGGGCTTGTGCAGGG - Intergenic
1078312932 11:10264499-10264521 CTGGCAAAATACCTGGCACATGG - Intronic
1078660596 11:13282541-13282563 CTGGGCCAAGGGCTGGTACAGGG - Intronic
1078986973 11:16606742-16606764 AAGGCAAAAGGGCAGGGACAGGG - Intronic
1080024261 11:27597229-27597251 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1080848385 11:36046237-36046259 CATGCAACAGAGCTGGTACAGGG - Intronic
1081737390 11:45413589-45413611 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
1082088356 11:48068445-48068467 CAGGCAAGAGGGCTTGTGCAGGG - Intronic
1084393976 11:68896842-68896864 CAGGCACAAGGGCAGGCACAGGG + Intronic
1084616936 11:70242695-70242717 CTGGCAGAAGACCTGGCACATGG - Intergenic
1084733154 11:71087408-71087430 CTGGCAAAAGGGCTGGCGGCTGG + Intronic
1085154766 11:74283282-74283304 ATGGCAACAGGGCTGTTATAAGG + Intronic
1085183062 11:74552336-74552358 CAGGCAAGAGGGCTTGTGCAGGG - Intronic
1085463117 11:76707059-76707081 GTGCCAGAAGGCCTGGTACAAGG + Intergenic
1086060360 11:82693877-82693899 CTGACAGAAGGCCTGGCACATGG - Intergenic
1086399497 11:86448803-86448825 CTGGCATAAGTGCTGGTAAATGG + Intronic
1086462686 11:87021173-87021195 CTAGCACAATGCCTGGTACATGG - Intergenic
1087052761 11:93903154-93903176 CTGGCAAAAAGGCTGATATGGGG + Intergenic
1087702784 11:101454859-101454881 CTTACAAAATGCCTGGTACATGG + Intronic
1090331974 11:125939504-125939526 CTGGCAACAGTGCTGCTACCAGG - Intergenic
1093780722 12:23133716-23133738 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
1095343805 12:41125000-41125022 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
1097244953 12:57602658-57602680 CTGGAAAAAGGGGTGGGAGAAGG - Exonic
1097587248 12:61529797-61529819 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
1097724629 12:63061019-63061041 CTAGCAAAAGAACTGGTAGATGG + Intergenic
1098676483 12:73295311-73295333 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1099111874 12:78572163-78572185 CAGGCAAAAAGGCTTGTTCAGGG + Intergenic
1099371502 12:81836035-81836057 CAGGCAAGAGGGCTTGTGCAGGG - Intergenic
1099625790 12:85071761-85071783 CAGGCCAAAGGGCTTGTGCAGGG + Intronic
1100113386 12:91272627-91272649 CTGCCAACAGGGCTGGGAGATGG + Intergenic
1100337408 12:93644404-93644426 CAGGCAAGAGGGCTTGTGCAGGG + Intergenic
1102197933 12:111037353-111037375 CTGGACACCGGGCTGGTACAAGG - Intronic
1102349572 12:112182445-112182467 ATGGCAAAAGGGCTGGAAAATGG + Intronic
1104065406 12:125301403-125301425 CTGGGCACAGGGCTGGTGCACGG - Intronic
1106942653 13:34794951-34794973 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
1110129913 13:71994683-71994705 CTGTCAAATGGGCTAATACAGGG - Intergenic
1110560588 13:76907440-76907462 CTGTAGAAAGGGCTGGTAAATGG - Intergenic
1110645384 13:77877510-77877532 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1112430494 13:99346474-99346496 CTGGCCTAAGGGCTTGCACACGG - Intronic
1112963397 13:105156959-105156981 CAGGCAAGAGGGCTTGTGCAGGG + Intergenic
1113538436 13:111086376-111086398 CAGGCAAGAGGGCTTGTGCAGGG - Intergenic
1113649440 13:112025600-112025622 CCGGCAAAAGTGCTGGGGCAAGG + Intergenic
1113666137 13:112143196-112143218 CTGGCCTCAGGGCTGGTACATGG + Intergenic
1113741731 13:112716164-112716186 CTGGCAAAAGGTCTATCACAGGG - Intronic
1114183305 14:20382776-20382798 CTGGCAGAGGGGCTGGTGCTGGG - Intronic
1116903600 14:50384416-50384438 CTGGAGAAATGGCTGATACAGGG + Intronic
1117106973 14:52407724-52407746 CTGGCAAGGGGGCTTGTGCAGGG - Intergenic
1117299621 14:54411845-54411867 CTGGCACAATGTCTGGTACAGGG + Intronic
1117748732 14:58898554-58898576 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1118116590 14:62784176-62784198 CAGGCAAGAGCGCTTGTACAGGG + Intronic
1118130908 14:62962226-62962248 CTGGTCAAAGGGCTGAAACAAGG - Intronic
1120965610 14:90165068-90165090 CTGGCAAGAGAGCTTGTGCAGGG + Intronic
1121401018 14:93677422-93677444 CAGGCAAAAGAGCTTGTGCAGGG + Intronic
1121572165 14:94954597-94954619 CTGGCTACAGGGCTGATTCATGG + Intergenic
1123816430 15:23984034-23984056 CTGCCAACAGGGCTTGTACTTGG + Intergenic
1124065609 15:26340937-26340959 GTGGCAGGAGGGCTGGCACAAGG + Intergenic
1124243814 15:28053431-28053453 CTGGCACAGGGGCTGGGAGAGGG - Intronic
1124692052 15:31831952-31831974 CTGGCGGAAGGGCTGGGGCAGGG + Intronic
1128105610 15:65042543-65042565 CTGGCATAATGCCTGGCACATGG + Intergenic
1128261001 15:66232767-66232789 CTGGCACAGGGCCTGGCACACGG - Intronic
1131353936 15:91726735-91726757 CTGGCATAAGGCCTGGCACAGGG + Intergenic
1131422574 15:92319618-92319640 CTGGGAAAAGGGAGGGGACAGGG - Intergenic
1134031453 16:10995619-10995641 CAGGCAAAATGCCTGGTACAAGG - Intronic
1135798907 16:25474443-25474465 CAGGCAAAAGAGCTTGTTCAGGG + Intergenic
1137331880 16:47505526-47505548 ATAGCACAAGGGCTGGTACCGGG + Intronic
1138094062 16:54198461-54198483 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
1138317707 16:56084461-56084483 AAGGCCACAGGGCTGGTACATGG - Intergenic
1139327345 16:66162792-66162814 CTGGCAAAATGCCTGGTGCACGG - Intergenic
1140202723 16:72907479-72907501 CTGGAGACAGGGGTGGTACAGGG - Intronic
1141280384 16:82625776-82625798 CTGGCACAGGGCCTGGAACATGG - Intergenic
1141627332 16:85268220-85268242 CTGGCACAAGGTGTGGCACAAGG + Intergenic
1147610802 17:41800971-41800993 CTGGAAAAAGGGCTGGGTCAAGG - Intergenic
1148408465 17:47442779-47442801 CAGGCAAGAGGGCTTGTGCAGGG + Intergenic
1151339882 17:73464342-73464364 CAGGCAAGAGGGCTTGTGCAGGG - Intronic
1151419531 17:73988057-73988079 CTGGCAGAAGGCCTGGCACAGGG + Intergenic
1151957529 17:77387905-77387927 CTGGGAACAGGGCTGGTGAAGGG - Intronic
1152074025 17:78147700-78147722 TTTGCTAAAGGGCAGGTACAGGG + Intronic
1155748447 18:29390379-29390401 CAGGCAACAGAGCTTGTACAGGG - Intergenic
1156965443 18:43085904-43085926 CAGGCAAGAGGGCTTGTGCAGGG - Intronic
1157414831 18:47493510-47493532 CAGGCAAAAGAGCTTGTATAGGG - Intergenic
1158875107 18:61726218-61726240 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
1160154059 18:76419670-76419692 CAGGCAAGAGGGCTTGTGCAGGG - Intronic
1160668078 19:342786-342808 CTGCCACAACGGCTTGTACATGG - Intronic
1161384435 19:3983477-3983499 CTGGCTATGGGGCTGGTACCAGG - Intronic
1161706628 19:5825175-5825197 CGGGCAAAAGTGCTGCTATAGGG + Intronic
1162935436 19:13979399-13979421 CGGGCAAAGGGGCTGGTCCCGGG - Intronic
1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG + Intronic
1163641999 19:18467215-18467237 CGGGCAGACTGGCTGGTACAGGG - Intronic
1166210486 19:41303779-41303801 CTGTCATAAGGGCTGGGACAGGG + Intronic
1167025940 19:46918204-46918226 CTGGAAAAAGGGCTGATTCCAGG - Intergenic
924963540 2:56586-56608 CAGGCAAGAGGGCTTGTGCAGGG + Intergenic
924973007 2:147973-147995 CAGGCAAGAGAGCTGGTACAGGG + Intergenic
925247770 2:2399654-2399676 CTCCCAGAAGGGCTGGTGCACGG - Intergenic
928325992 2:30319965-30319987 CTGGAAATGGGGCTGGTAGATGG - Intronic
929101875 2:38323035-38323057 CTAGAAAAATGGCTGGCACATGG - Intronic
930375839 2:50565846-50565868 CAGGGAGAAGGGCTGGGACATGG - Intronic
931966987 2:67545503-67545525 CTGGCAAGAGAGCAGGTGCATGG + Intergenic
932449144 2:71798612-71798634 CTGGCCAAAGGGCCTTTACAAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933830138 2:86200037-86200059 CCGGCACAAGGGCTGGTATGAGG + Intronic
937788163 2:125926571-125926593 ATGGAAAAAGGACAGGTACAGGG + Intergenic
939776546 2:146394437-146394459 CTGACAGAAGGGCAGGTACATGG + Intergenic
941718624 2:168789396-168789418 CAGGCAAGAGGGCTTGTATAGGG + Intronic
941773909 2:169371177-169371199 CTGGCAAAAGGCCCAATACATGG + Intergenic
942489480 2:176475307-176475329 CTGGCAAGAGGACTTGTGCAGGG + Intergenic
943153002 2:184138195-184138217 CTGGCAGAAGTGTTGGCACAGGG + Intergenic
944419105 2:199509797-199509819 CTAGCAAAATGGCTGGCAAATGG - Intergenic
945812005 2:214559979-214560001 CTGAAACAATGGCTGGTACATGG + Intronic
947003471 2:225485206-225485228 CAGGCAAAAGAGCTTGTGCAGGG - Intronic
948040181 2:234895422-234895444 CAGGCAAGAGAGCTGGTGCAGGG + Intergenic
1169152384 20:3299732-3299754 CTGGCAAAAGGTCAGGCATATGG - Intronic
1169639252 20:7731538-7731560 CTGGCAAGAGAGCTTGTGCAGGG + Intergenic
1169850377 20:10042714-10042736 ATGGCAAAAGAGATGGTACTGGG - Intronic
1170180501 20:13524514-13524536 CTGGCAAACAGCCTTGTACAGGG - Intronic
1170883588 20:20318756-20318778 CTGGCCTCAGGGCTGGGACATGG - Intronic
1170910429 20:20561300-20561322 CATGGAAAAGGGCTGGTGCATGG - Intronic
1171775606 20:29364518-29364540 CAGGCAAAAGGGCTTGTGTAGGG - Intergenic
1171817617 20:29802312-29802334 CAGGCAAAAGGGCTTGTGTAGGG - Intergenic
1171900718 20:30853779-30853801 CAGGCAAAAGGGCTTGTGTAGGG + Intergenic
1172595616 20:36149239-36149261 CTGGCAAAGGGGCTGGGGCAGGG - Intronic
1177871710 21:26580772-26580794 CTGGCAAGAGAGCTTGTGCATGG - Intergenic
1178404170 21:32311127-32311149 CAGGCAAAAGGGCATGTGCAGGG + Exonic
1178855604 21:36247926-36247948 ATGGGCAAAGGGCTGGCACAGGG - Intronic
1178971100 21:37177623-37177645 CAGGCAGAAGGGATGGTACTGGG - Intronic
1180013400 21:45066174-45066196 CTGGAAAGACTGCTGGTACAAGG + Intergenic
1180320954 22:11320983-11321005 CAGGCAAAAGGGCTTGTGTAGGG - Intergenic
1180334089 22:11559762-11559784 CAGGCAAAAGGGCTTGTGTAGGG + Intergenic
1180985954 22:19904014-19904036 AAGGCAAACGGGCTGGCACAAGG + Intronic
1181106643 22:20579598-20579620 AGGGCAAAAAGGCTGGTCCAGGG - Intronic
1182255182 22:29032751-29032773 CCGGCAAAAGGCCTGGCACAGGG - Intronic
1184712593 22:46262062-46262084 CTGGCAAAAGTGTCAGTACAGGG + Exonic
1185065100 22:48628165-48628187 CTGGCAGGAGGGCTGTTTCAGGG + Intronic
949146399 3:705759-705781 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
949264421 3:2140062-2140084 CAGGCAAGAGGGCTTGTGCAGGG - Intronic
950328602 3:12137438-12137460 ATGACAGAAGTGCTGGTACAAGG - Intronic
951067050 3:18278619-18278641 CTGGCAAATGGGTGGGCACATGG - Intronic
952068973 3:29609660-29609682 CTGGCAAAAGGCCTGATACATGG + Intronic
953667507 3:44936363-44936385 CTGGCGAAAGTGCAGATACAAGG + Intronic
954389578 3:50261577-50261599 CTGGGACAGGGGGTGGTACAGGG - Intergenic
954448656 3:50560026-50560048 CTAGCACAGGGGCTGGTACAAGG + Intronic
957259370 3:77880159-77880181 CAGGCAAGAGGGCTTGTGCAGGG - Intergenic
957444780 3:80301881-80301903 CAGGCAAAAGGGCATGTGCAGGG + Intergenic
957563903 3:81860707-81860729 CAGCCACATGGGCTGGTACAAGG + Intergenic
957676640 3:83376557-83376579 CAGGCAAGAGGACTTGTACAGGG + Intergenic
957676888 3:83378412-83378434 CAGGCAAGAGGGCTTGTGCAGGG + Intergenic
957843198 3:85698216-85698238 CTGTCAGAGGGGCTGGTCCAAGG + Intronic
960744285 3:120869351-120869373 CTGGCAAATGGCCTTGGACAAGG + Intergenic
961135048 3:124502412-124502434 CAGGCACAAGAGCTGGGACATGG + Intronic
961369963 3:126423059-126423081 CTGGCGACAGGTCTGGAACATGG + Intronic
961827373 3:129606193-129606215 CTGGCAGAAGCCCTGGTAGATGG + Exonic
964313600 3:155420005-155420027 CAGGCAAAAGAGCTTGTGCAGGG - Intronic
966285515 3:178290695-178290717 CTGTCAAAAGGGCTGTAATACGG - Intergenic
967439365 3:189488987-189489009 ATGGGAAAATGGCTGGTGCAGGG - Intergenic
970534370 4:17014272-17014294 CTGGCAGAAGGGCTGGAAGCAGG - Intergenic
972402014 4:38714022-38714044 CAGGCAAGAGAGCTGGTGCAGGG + Intergenic
972735492 4:41836980-41837002 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
972926395 4:44014294-44014316 CAGGCAAGAGGGCTTGTGCAGGG - Intergenic
973613142 4:52656633-52656655 CGGGCACAGGGCCTGGTACATGG - Intronic
973653949 4:53026370-53026392 CTAGCACAATGCCTGGTACATGG + Intronic
974153661 4:58043307-58043329 CAGGCAAAAGAGCTTGTACAGGG - Intergenic
976346336 4:84006342-84006364 TTGGCAAAATGGCTGGTTCTAGG - Intergenic
977303939 4:95299686-95299708 CAGGCAAGAGGGCATGTACAAGG + Intronic
977360036 4:95991246-95991268 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
979218679 4:118195408-118195430 CAGGCAAGAGAGCTTGTACAGGG - Intronic
979569223 4:122197620-122197642 CTGCCCAAACGTCTGGTACAGGG - Intronic
979840724 4:125436694-125436716 CAGGCAAGAGAGCTTGTACAGGG + Intronic
980272757 4:130607989-130608011 CTGGCCAAAGTGCTGGGTCAAGG - Intergenic
980308625 4:131099246-131099268 CTGGCACAAGGGCTGACACCTGG - Intergenic
982586432 4:157247171-157247193 CTGGCACAAGGCCAGGCACAGGG - Intronic
983645327 4:169984239-169984261 CTGACAAAGGGCCTGCTACATGG + Intergenic
985816464 5:2131664-2131686 CTGGCGAAGAGGCTGGGACAAGG - Intergenic
986407354 5:7439329-7439351 CAGGCAAGAGAGCTTGTACAGGG + Intronic
987223682 5:15817685-15817707 CAGGCAAGAGGGCTTGTGCAGGG - Intronic
987716831 5:21582257-21582279 ATGGCAAAATGCTTGGTACATGG + Intergenic
988307234 5:29507899-29507921 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
988410900 5:30884652-30884674 CAGGCAAAAGGGCATGTGCAGGG - Intergenic
988540298 5:32102366-32102388 CTGGCAAAAGAGCAGGTCCCAGG - Intronic
988805816 5:34739722-34739744 CTGGCACAAGGGCTGACACAAGG - Intronic
991460580 5:66854434-66854456 CTGGCACCAGGTCTGTTACAAGG + Intronic
992005786 5:72476178-72476200 CTAGAAGAATGGCTGGTACATGG + Intronic
993208940 5:84922324-84922346 CAGGCAAGAGAGCTTGTACAGGG - Intergenic
993686319 5:90942623-90942645 CTGGCAAAAGGGGTGGTAACAGG + Intronic
993778591 5:92035519-92035541 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
994857453 5:105142645-105142667 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
995137294 5:108693483-108693505 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
998556961 5:143134869-143134891 CTGGCATAAGGCCTGGGACATGG + Intronic
998697230 5:144653834-144653856 CAGGCAAAAGAGCTGGTGCAGGG + Intergenic
999061069 5:148636043-148636065 CTGGCAAAATCCCTGGTACATGG - Intronic
999127116 5:149253993-149254015 CAGGCAAGAGAGCTTGTACAGGG + Intronic
999673178 5:153975158-153975180 CTGGCAGGAGTGCTGGTAAAAGG - Intergenic
1000297192 5:159922190-159922212 CTAGCAGAATGTCTGGTACATGG - Intronic
1004365043 6:15005717-15005739 CTAGCAAAATGGCTGGCACTAGG - Intergenic
1004460424 6:15829966-15829988 CTGGCACATGGGATGGAACATGG - Intergenic
1004507072 6:16255414-16255436 CTGGCAGTAGGGGTGGGACATGG - Intronic
1004863124 6:19826385-19826407 CTTGCTAATGGGATGGTACATGG - Intergenic
1004959187 6:20766454-20766476 CTAGCAGAAGGGCTGGGTCATGG - Intronic
1006592311 6:35167380-35167402 CTGGCACAAAGGCAGGTACATGG - Intergenic
1007205821 6:40149749-40149771 CTGGCAAAAGGGAAGGAATATGG + Intergenic
1007549395 6:42717439-42717461 CCGGCAAAAGGGCAGGGAGAGGG - Intronic
1008454042 6:51687993-51688015 CTTGAGAAAGGGCTGGTACTAGG + Intronic
1009581153 6:65535431-65535453 CAGGCAAGAGGGCTTGTGCAGGG - Intronic
1009736312 6:67680492-67680514 CTGGTATAAGGGCTGGTATAAGG - Intergenic
1012511885 6:100011743-100011765 CTGGCCAAAGGATTGGTTCAAGG + Intergenic
1012832952 6:104228750-104228772 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1014562155 6:122904476-122904498 CAGGCAAAAGGGCTTGTGCAGGG - Intergenic
1015298865 6:131630252-131630274 CTGGCATAAAGTCTGGTACTTGG + Intronic
1015721712 6:136249712-136249734 CAGGCAAGAGGGCTTGTGCAGGG - Intronic
1015936726 6:138412122-138412144 CTGGAAAAGGGGCTTCTACAGGG + Intronic
1017289703 6:152721771-152721793 ATGGCAATCGGGCTGGTACTTGG + Exonic
1018550980 6:164998480-164998502 CTGTCAAAATTGCTGATACAAGG + Intergenic
1020736001 7:11950118-11950140 CTGGCAACAATGTTGGTACAGGG + Intergenic
1020877625 7:13717875-13717897 CATGCAAAAGGGATTGTACAAGG + Intergenic
1022416073 7:30178156-30178178 CTGGCATAATGCCTGGCACATGG + Intergenic
1022978117 7:35576983-35577005 CAGGCAAAAGAGCTTGTGCAGGG + Intergenic
1023734759 7:43224916-43224938 CTGGAAAAAGGGCAGGGATAAGG + Intronic
1024226722 7:47330998-47331020 CTGGGAGTAGGGCTGGTCCAGGG - Intronic
1025200260 7:56957363-56957385 CTGTCAAAAGGGCTGGGTGAAGG + Intergenic
1025671685 7:63619569-63619591 CTGTCAAAAGGGCTGGGTGAAGG - Intergenic
1026122293 7:67548503-67548525 CAGGCAAGAGGGCTTGTGCAGGG - Intergenic
1026220250 7:68390069-68390091 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
1027113837 7:75462643-75462665 CTGCCAAAAGAACTGATACAGGG + Intronic
1027286088 7:76647248-76647270 CTGCCAAAAGAACTGATACAGGG + Intergenic
1027740437 7:81996111-81996133 TTAGCAAAAGGCCTGGTTCATGG - Intronic
1028160334 7:87476999-87477021 CTGGCCAGACAGCTGGTACATGG - Intronic
1032963371 7:137066682-137066704 CAGGCAAGAGGGCTTGTGCAGGG - Intergenic
1036217491 8:6892832-6892854 CAGGCAAAAGGAGTGGTGCAGGG + Intergenic
1037432934 8:18832774-18832796 CAGGCAAAAGAGCAGGTGCAGGG + Intronic
1037698423 8:21249004-21249026 CTGACATAAGGGCTGGGGCAGGG - Intergenic
1037803582 8:22048030-22048052 CCGGCACGAGGGCTGGTTCATGG + Exonic
1039209525 8:35196903-35196925 CAGGCAAGAGGGTTGGTGCAGGG - Intergenic
1039386518 8:37140777-37140799 GTGGCAAAGGGAATGGTACAGGG + Intergenic
1041465429 8:58153611-58153633 CTGGCAGAGGGGCTGGAACAGGG + Intronic
1042470242 8:69179151-69179173 CTGGCAAGAGGGCATGTGCAGGG - Intergenic
1044846654 8:96388644-96388666 CAGGCAAGAGGGCTTGTTCAGGG - Intergenic
1044858869 8:96502196-96502218 CAGGCAAGAGAGCTTGTACAGGG + Intronic
1045094347 8:98782246-98782268 CTGCCAGAAGGGCAGGTACATGG + Intronic
1045285618 8:100788946-100788968 CCAGCAAAGGGCCTGGTACAAGG - Intergenic
1046065815 8:109195706-109195728 CTGGCAAGAGAGCTTGTTCAGGG + Intergenic
1046705307 8:117442875-117442897 CTGGCATAAGTTCTGGTTCATGG - Intergenic
1047594859 8:126368144-126368166 CAGGCAAGAGGGCTTGTGCAGGG + Intergenic
1048254903 8:132898336-132898358 CTGGCTGAAGGGCTGGGCCATGG - Intronic
1051179362 9:14394483-14394505 CAGGCAAAAGAGCTTGTGCAAGG + Intronic
1051887563 9:21910543-21910565 CTGGCAAGAGGGCTAGTGTATGG + Intronic
1053163623 9:35829650-35829672 CTGGGAATGGGGCTGGGACAGGG - Exonic
1055016999 9:71629416-71629438 CTGGCACAGTGGTTGGTACATGG + Intergenic
1057077423 9:92145893-92145915 TTGGCATAATGTCTGGTACATGG + Intergenic
1058047289 9:100370275-100370297 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
1058142724 9:101375170-101375192 CAGGCAAAAGAGCTTGTGCAGGG - Intronic
1058780934 9:108334018-108334040 TTGGCAGAATGGCTGGCACATGG - Intergenic
1059747154 9:117214326-117214348 CTGGAAAATGGGCTGTGACATGG + Intronic
1060178990 9:121518764-121518786 ATGACAATAGGGCTGGGACAAGG + Intergenic
1060414734 9:123422137-123422159 CTGGCACAAGGCCTGGCACGCGG + Intronic
1060815568 9:126633341-126633363 CTGGCACAGGGCCTGGTACTTGG + Intronic
1061813619 9:133179383-133179405 CTGTTACAAGGGCTGGTGCACGG + Intergenic
1203369175 Un_KI270442v1:286758-286780 CAGGCAAAAGGGCTTGTGTAGGG - Intergenic
1185826976 X:3260956-3260978 CAGGCAAGAGGGCTTGTGCAGGG - Intergenic
1186029099 X:5347472-5347494 CAGGCAAGAGGGCTTGTGCAAGG + Intergenic
1187678772 X:21744924-21744946 CTGGCAACAGAGCTTGTACAAGG - Intronic
1187726795 X:22211848-22211870 CAGGCAAGAGAGCTTGTACAGGG + Intronic
1187796323 X:23007707-23007729 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
1188090548 X:25959255-25959277 CAGGCAAAAGAGCTTGTGCAGGG - Intergenic
1190436007 X:50426186-50426208 CTGTAAAATGAGCTGGTACAGGG - Intronic
1190449825 X:50567775-50567797 TAGGCAAAAGGCCTGCTACATGG - Intergenic
1190545638 X:51523572-51523594 CTGACTCAAGGGCTGGAACAGGG - Intergenic
1192227805 X:69241399-69241421 CTGGCAGTAGGGCTGGGGCAGGG - Intergenic
1193191281 X:78573761-78573783 CTGTCAAAACAGGTGGTACATGG - Intergenic
1193516115 X:82466447-82466469 CAGGCAAGAGAGCTTGTACAGGG + Intergenic
1196908656 X:120464398-120464420 CTAGCATAGGGTCTGGTACATGG - Intronic
1197720235 X:129740013-129740035 CTGGCACAAGGCCTGGCACTGGG - Intronic
1201069104 Y:10128203-10128225 CAGGCAAAAGGGCTTGTGTAGGG + Intergenic