ID: 903759190

View in Genome Browser
Species Human (GRCh38)
Location 1:25685871-25685893
Sequence GACTCGTATGGTGATTTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903759186_903759190 4 Left 903759186 1:25685844-25685866 CCAGGGCAGGTCAAAGGAGTTCA 0: 1
1: 0
2: 2
3: 45
4: 786
Right 903759190 1:25685871-25685893 GACTCGTATGGTGATTTTAGGGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903759190 Original CRISPR GACTCGTATGGTGATTTTAG GGG Intronic
902776116 1:18676107-18676129 TACTCTAATGGTGATTTTTGAGG - Intronic
903759190 1:25685871-25685893 GACTCGTATGGTGATTTTAGGGG + Intronic
916396829 1:164399766-164399788 GATTAGGATGGTGATTTTAAAGG + Intergenic
1076236042 10:128864502-128864524 GACTCTTATGGTGTTTCTTGGGG - Intergenic
1079740519 11:24053514-24053536 AACTAGTATGGTGATAATAGTGG - Intergenic
1088734907 11:112720611-112720633 GACTTGTATTTTGATTTTACAGG + Intergenic
1091934089 12:4421571-4421593 GACTGGGATGCTGATTTTAGAGG - Intergenic
1098458468 12:70703746-70703768 GAATGGCATGGTGATTTTAAAGG - Intronic
1098985605 12:77008650-77008672 GACTAGCATTGTGATTTTAGGGG + Intergenic
1127205043 15:56707250-56707272 GAGTCACATGGTGAGTTTAGAGG - Exonic
1135017107 16:18933010-18933032 GACTGGCATGGTGATTTTAATGG + Intergenic
1142685186 17:1573566-1573588 CACTCGTTTTGTGATGTTAGTGG - Intronic
1146200691 17:30855426-30855448 CATTCTTATGGTGACTTTAGTGG + Intronic
1157405448 18:47418916-47418938 GACTCCTAACGAGATTTTAGAGG - Intergenic
1158115823 18:53994005-53994027 GACTCTACTGGTGATTTCAGGGG + Intergenic
1160423673 18:78766402-78766424 GCCTTGAATCGTGATTTTAGGGG - Intergenic
936650748 2:114423303-114423325 GAATTGTATAGTTATTTTAGGGG - Intergenic
938944474 2:136199352-136199374 GGCTCATATGGTGATCTTGGTGG - Intergenic
943486516 2:188491338-188491360 CACTTATATGCTGATTTTAGTGG - Intronic
1174691703 20:52512693-52512715 GAATCTTATGGTGCTTTTCGTGG - Intergenic
1174846270 20:53946187-53946209 GATTTGGATGGTGGTTTTAGGGG - Intronic
1175453015 20:59086323-59086345 GACACAAATCGTGATTTTAGGGG + Intergenic
1178781599 21:35608573-35608595 GACTGGTATGGTGATTGTGCAGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
964425088 3:156544222-156544244 GACTTGTCTGGATATTTTAGTGG - Intronic
970335092 4:15029721-15029743 GAGTAGTATGGTGATTTTCATGG + Intronic
973777613 4:54257543-54257565 GACTAACATGGTGATTTTTGGGG + Intronic
976717073 4:88134572-88134594 CAAGCTTATGGTGATTTTAGAGG - Intronic
980896199 4:138863153-138863175 GACTTGTGTGATAATTTTAGGGG - Intergenic
984076757 4:175191410-175191432 GAGTAGAATGGTGATTGTAGGGG + Intergenic
986731823 5:10640135-10640157 GAGTTGTGTGGTGATGTTAGCGG + Intronic
987440429 5:17949586-17949608 GACTTGTCTAGTGCTTTTAGTGG + Intergenic
987603951 5:20108550-20108572 GATGAGTGTGGTGATTTTAGAGG - Intronic
992303680 5:75411632-75411654 TACTTTTAAGGTGATTTTAGTGG - Intronic
993166802 5:84366343-84366365 GACTTGTAAGGTTATTTTAAGGG - Intronic
996810461 5:127511697-127511719 GGCTCATATGGTGATCTTGGTGG - Intergenic
1000560559 5:162783279-162783301 AACTCATATTGTTATTTTAGTGG + Intergenic
1000678026 5:164146557-164146579 GGCTGGTGTGGTGATTTAAGGGG + Intergenic
1000782723 5:165503433-165503455 GACCCGTATGGCATTTTTAGAGG - Intergenic
1005396090 6:25383240-25383262 GGCTCGGATGGTGGTTTTTGAGG + Intronic
1007145468 6:39625625-39625647 GTCTCCTATGGGGATTTGAGGGG - Intronic
1015966792 6:138702297-138702319 GACTCATGTGTTGACTTTAGAGG - Intergenic
1017431666 6:154377419-154377441 GGCTTGTATGGTCATTTTTGTGG + Intronic
1036730600 8:11260422-11260444 GACACGTATGGATATTTTAAAGG - Intergenic
1041216734 8:55608258-55608280 AACTCGTATGGTGATGGTAAGGG - Intergenic
1041481437 8:58324168-58324190 GACTTGTATGGTGATACCAGAGG + Intergenic
1056169528 9:83970774-83970796 GGCTCATATGGTGATCTTGGTGG - Exonic
1056506089 9:87259611-87259633 GACTCCTATGGGGATATTTGTGG - Intergenic
1188053591 X:25515607-25515629 GACTCGTTTGATGAGATTAGTGG + Intergenic