ID: 903763373

View in Genome Browser
Species Human (GRCh38)
Location 1:25715343-25715365
Sequence CAGAACATGGACTAGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903763367_903763373 11 Left 903763367 1:25715309-25715331 CCCATTGCTGGGGTCAAGGCAGT 0: 1
1: 0
2: 1
3: 14
4: 141
Right 903763373 1:25715343-25715365 CAGAACATGGACTAGGAGTTGGG 0: 1
1: 0
2: 1
3: 28
4: 237
903763362_903763373 30 Left 903763362 1:25715290-25715312 CCTAGGTCACATGATCATTCCCA 0: 1
1: 0
2: 3
3: 14
4: 185
Right 903763373 1:25715343-25715365 CAGAACATGGACTAGGAGTTGGG 0: 1
1: 0
2: 1
3: 28
4: 237
903763368_903763373 10 Left 903763368 1:25715310-25715332 CCATTGCTGGGGTCAAGGCAGTT 0: 1
1: 0
2: 0
3: 14
4: 143
Right 903763373 1:25715343-25715365 CAGAACATGGACTAGGAGTTGGG 0: 1
1: 0
2: 1
3: 28
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903763373 Original CRISPR CAGAACATGGACTAGGAGTT GGG Intronic
903317716 1:22521647-22521669 CAGAACATGCAGGTGGAGTTTGG + Exonic
903763373 1:25715343-25715365 CAGAACATGGACTAGGAGTTGGG + Intronic
904891263 1:33781386-33781408 CTGAAAATGGACTATGAATTAGG + Intronic
905321582 1:37120956-37120978 CAGACCAGGGACTAGGAATGTGG + Intergenic
905489336 1:38331483-38331505 AAGAACATGGACCAAGAGGTTGG - Intergenic
907416162 1:54315413-54315435 CAGCAGATGGACTTGGTGTTTGG + Intronic
907505038 1:54911910-54911932 CAGAGCATGGACTAGCAGGCCGG + Intergenic
907592568 1:55689836-55689858 CAGAGCATGGATGAGGAGGTGGG + Intergenic
908095579 1:60733657-60733679 CAGAACATCTACCATGAGTTAGG + Intergenic
908991003 1:70089104-70089126 CAGCTCCTGGAGTAGGAGTTAGG - Intronic
911771100 1:101743728-101743750 CAGAACTTACACTAGGAGCTGGG - Intergenic
912045689 1:105452796-105452818 CACAAGATAGACTAGAAGTTGGG + Intergenic
912701334 1:111880512-111880534 CAGGACATGGACTGGGAGAGAGG + Intronic
915770928 1:158422518-158422540 CAGCAAATGTACTAGGAATTGGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917726956 1:177837397-177837419 GGGAAAATGGATTAGGAGTTAGG + Intergenic
919979989 1:202637022-202637044 TAAAACATGGACTAGGGGCTGGG + Intronic
920903637 1:210137497-210137519 GAGAAAATGGACTAGGACTTAGG - Intronic
924017277 1:239741016-239741038 CAGAACACAGACAAAGAGTTAGG - Intronic
924063533 1:240200791-240200813 GAGAACATGGAAAAAGAGTTGGG - Intronic
1063361488 10:5463026-5463048 TAGAGCATGGCCTGGGAGTTTGG - Intergenic
1063772640 10:9221826-9221848 AAGAACATAAACTTGGAGTTTGG + Intergenic
1064368202 10:14727255-14727277 CAGTACATGGCCCAGGAGTTGGG + Intronic
1065999008 10:31086807-31086829 CTGAAAATGGACTACAAGTTAGG + Intergenic
1067205762 10:44211446-44211468 CAGAGCATGGACTTGAACTTAGG + Intergenic
1067485576 10:46646736-46646758 CAGAATAAGGACTAGGAGCTGGG - Intergenic
1067609183 10:47694916-47694938 CAGAATAAGGACTAGGAGCTGGG + Intergenic
1068054909 10:51999913-51999935 CAGAATATGGATCAGAAGTTTGG + Intronic
1068063783 10:52102904-52102926 CAGTCCATGGCCCAGGAGTTGGG - Intronic
1068704181 10:60055293-60055315 AAGAACACGGAGTGGGAGTTAGG + Intronic
1069131351 10:64708070-64708092 CAGAACAAGGACTAGCAGGTTGG + Intergenic
1069559223 10:69417850-69417872 CAGAAAATGGACTGGGAGTGTGG - Intergenic
1071102650 10:82057305-82057327 CAGAAATTGGAGTAGGAGTTAGG - Intronic
1071624770 10:87156562-87156584 CAGAATAAGGACTAGGAGCTGGG + Intronic
1071767543 10:88685127-88685149 AAGAACATTTACTGGGAGTTGGG + Intergenic
1073539619 10:104307573-104307595 CAGCACAGGGACTAAGAGTGTGG - Intergenic
1074559431 10:114521911-114521933 GAGAAGATGGCCTAGGGGTTGGG + Intronic
1078063214 11:8061510-8061532 CAGAGCAGGGCCTAGGAGTTGGG + Intronic
1079243660 11:18738038-18738060 CAGCCCCTGGGCTAGGAGTTGGG - Intronic
1079780718 11:24599507-24599529 CAGAACAATGACTAGGAAATAGG - Intronic
1080457877 11:32431809-32431831 CCACACATGGACTAAGAGTTTGG + Intronic
1080510902 11:32970381-32970403 CAAAAACTGGACTAGGAGTCAGG - Intronic
1081284090 11:41246365-41246387 CAGAACAGGCACTGGGAGTAGGG + Intronic
1083758654 11:64804259-64804281 CAGAACATGGGCTCAGAGTTGGG + Exonic
1085587695 11:77726617-77726639 CAGGCCCTGGACTAAGAGTTGGG + Intronic
1085742946 11:79092414-79092436 GAGAACTTGGCCTAGGAGTCAGG - Intronic
1086213409 11:84348651-84348673 CACAACAGGTACTAGGAGGTAGG - Intronic
1086607436 11:88712668-88712690 CAGAAAATAGACTAGGAGTCAGG + Intronic
1088035013 11:105300718-105300740 CAGAGCCTGCACTAGGACTTGGG - Intergenic
1088504803 11:110517137-110517159 AAGAACATGGACTAAGAGGAAGG + Intergenic
1088852816 11:113719257-113719279 AAGATCCTGGACTAGGAGTCAGG - Intergenic
1090726734 11:129533864-129533886 CAGAACTTGGACTAGAACATGGG + Intergenic
1091277608 11:134362896-134362918 CAGTAAATGGTCTAGGAGTGCGG - Intronic
1091789097 12:3261062-3261084 CAGAACACAGGGTAGGAGTTCGG - Intronic
1093545360 12:20338730-20338752 CAGCACATGGAATAGTACTTGGG + Intergenic
1096797848 12:54089794-54089816 GAGAACATGGTCAAGGAGTTGGG + Intergenic
1096857446 12:54494556-54494578 CTGAAGATTGACTAGGATTTGGG + Intergenic
1097919993 12:65061601-65061623 CAGAGCCTGGACAAGCAGTTTGG + Intronic
1099333156 12:81317648-81317670 GAGAAAATGTAATAGGAGTTAGG - Intronic
1100567312 12:95809604-95809626 CAGGCCACGGACCAGGAGTTGGG + Intronic
1100927548 12:99566843-99566865 CAGAAAATGGACTAAGACATAGG + Intronic
1101373374 12:104150490-104150512 CAGTCCATGGCCTAGGGGTTGGG - Intergenic
1103117369 12:118347842-118347864 GAGAACTTGGACTAGTAGTGAGG - Intronic
1103311378 12:120011862-120011884 CAGAACATGGGCTAGAACCTAGG - Intronic
1104133171 12:125914052-125914074 AATAACATGGACTAAGAGATAGG - Intergenic
1104463738 12:128974138-128974160 CAGAAAAGGAACTAGGAATTTGG - Intronic
1105954636 13:25268936-25268958 CAGAACAGGCAGTGGGAGTTGGG - Intronic
1106909815 13:34451635-34451657 GAGTACATGGGCTAGGACTTAGG - Intergenic
1107601259 13:42015109-42015131 CAGAACCAGGACTCAGAGTTGGG + Intergenic
1112827506 13:103408609-103408631 GGGAACATGGAGCAGGAGTTGGG - Intergenic
1113763961 13:112869361-112869383 CAGAACTGGGATAAGGAGTTAGG - Intronic
1116227714 14:42172772-42172794 CAGAGCATGGACTGGGAATTTGG + Intergenic
1116443857 14:44985734-44985756 CAGTCCATGGCCCAGGAGTTGGG + Intronic
1116982466 14:51186168-51186190 CAGTCCATGGCCCAGGAGTTGGG - Intergenic
1118070562 14:62242806-62242828 CAGAAAAAGAACTAGGACTTAGG + Intergenic
1118396910 14:65345487-65345509 CTGAACACGGACTATGTGTTGGG + Intergenic
1119012119 14:71004296-71004318 CAGTCCATGGCCTGGGAGTTGGG - Intronic
1119580046 14:75770274-75770296 CAGAACATGAACTAAGAATAAGG - Intronic
1121484938 14:94307177-94307199 AAGAACATAGACCAGGTGTTTGG - Intronic
1122655989 14:103259544-103259566 CAGGACATGGAATAGAAGTACGG - Intergenic
1122863961 14:104595208-104595230 CAGGACATCGACTTGGAGCTGGG - Exonic
1124495608 15:30185065-30185087 TAAAACATGGACTAGGGGCTGGG + Intergenic
1124691938 15:31830894-31830916 GAGAACATGGGATAGAAGTTTGG + Intronic
1124747965 15:32353581-32353603 TAAAACATGGACTAGGGGCTGGG - Intergenic
1127540204 15:59929907-59929929 CGAAAGATGGACTAGGAGTGGGG + Intergenic
1127931219 15:63598772-63598794 CAGAAGATGGACTTGGGGTTGGG + Intronic
1131116804 15:89801044-89801066 CAGAACATGGGCCAGGAGCTAGG + Intronic
1133224906 16:4336441-4336463 CAGAACATGGCCTTGGAGGCCGG - Intronic
1137883119 16:52073392-52073414 TAGAACAGTGACTAAGAGTTTGG - Intronic
1144291208 17:13828246-13828268 CAGAAGATGAAGTAGGAATTAGG - Intergenic
1145030805 17:19503769-19503791 CAGGGCAAGGACTAGGAGTGAGG - Intronic
1146649026 17:34595195-34595217 CAGAGCACAGCCTAGGAGTTAGG + Intronic
1148800474 17:50221866-50221888 CAGAACCAGGACCAGGAGATAGG - Intergenic
1150064315 17:62096078-62096100 CAGAACATGGACCAGCAAATTGG + Intergenic
1150464117 17:65377264-65377286 TAGAACATGGACATAGAGTTTGG - Intergenic
1154390043 18:13928973-13928995 CATAACATGGTCTTGGAGTAAGG + Intergenic
1155328693 18:24692227-24692249 GAGAACAAGAACTAGCAGTTGGG + Intergenic
1155782796 18:29859109-29859131 CAGACCATTGCCTAGGAGGTCGG - Intergenic
1156697954 18:39790642-39790664 CAGAACAAGGATTAGGGGTAGGG + Intergenic
1157270787 18:46274438-46274460 CAGTAGAGGGACTAGTAGTTGGG + Intergenic
1158146831 18:54323513-54323535 CAGAAAATGGACTAAGACATTGG + Intergenic
1158248805 18:55463396-55463418 AAGACCATGGAATAAGAGTTGGG - Intronic
1159222387 18:65481547-65481569 CAGTCCATGGCCTAGGGGTTGGG + Intergenic
1159321605 18:66857967-66857989 CAGTACATGAACTTGGAGCTAGG + Intergenic
1159796388 18:72849320-72849342 CAGAAAATGGAATATGTGTTTGG - Intronic
1162833383 19:13300684-13300706 CAAAACATGAACTAGGCCTTGGG + Intronic
1162973800 19:14196791-14196813 CAGGACATGGTGTAGGAGTGTGG - Intronic
1165309109 19:35019845-35019867 CAGAACATTCACTGGCAGTTAGG + Intronic
1165378858 19:35463588-35463610 AAGAACATTGACAAAGAGTTTGG - Intergenic
926460299 2:13121482-13121504 TAGAATATGGAATAGGAATTAGG - Intergenic
932294396 2:70612460-70612482 CAGAACAGGGATTAAGAGTAAGG + Intronic
933837454 2:86257394-86257416 TAGAAAAGGGACTAGGGGTTAGG - Intronic
934097771 2:88623315-88623337 AAGAACATGGACAACGAGATTGG + Intronic
936347832 2:111688620-111688642 CAGAACAGGGAGTGAGAGTTTGG - Intergenic
937340289 2:121086788-121086810 CGGTACATGGACTTGGAATTTGG + Intergenic
938127145 2:128682750-128682772 CAGAGCACTGACTTGGAGTTGGG - Intergenic
939105714 2:137946213-137946235 CAGAACATGGACAGGTGGTTGGG + Intergenic
939168655 2:138667655-138667677 CAGAATATGGGGTAGGAGATTGG + Intergenic
940670423 2:156660918-156660940 CAGGCCATGGACCAGGGGTTGGG - Intergenic
941150229 2:161905463-161905485 CAGGCCATGGACCAGGGGTTGGG + Intronic
941442493 2:165555562-165555584 CAGATACTGGACTAGGAGCTGGG + Intronic
944626532 2:201575401-201575423 CAGTCCATGGCCTAGGGGTTGGG - Intronic
947178019 2:227387118-227387140 CAGAGCATGGACTTGAATTTGGG + Intergenic
948181021 2:235980430-235980452 CTAAAAATTGACTAGGAGTTCGG - Intronic
949072444 2:242033675-242033697 CAGAAAATGGGCTAGGAGGAGGG - Intergenic
1168873195 20:1148414-1148436 CAAAACATGGAGCAGGATTTGGG - Intronic
1168881445 20:1209546-1209568 CAGATGCTGGACAAGGAGTTGGG + Intergenic
1170382638 20:15777976-15777998 AAGAACACTGACTAGGAGTTGGG - Intronic
1171849689 20:30299622-30299644 GAGAACATGGTCAAGGAGTTGGG + Intergenic
1173140542 20:40478020-40478042 CAAACCTTGCACTAGGAGTTAGG + Intergenic
1174380148 20:50151041-50151063 TAGAACATGGACTAGAACATAGG + Intronic
1181359621 22:22324366-22324388 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181369693 22:22406104-22406126 GAGAAGATGGACAAGGAGGTAGG + Intergenic
1181901411 22:26159395-26159417 GAGAACATGGAACAGGAGCTGGG + Intergenic
1182434784 22:30323554-30323576 CAGAACTAGGACTTGGACTTAGG - Intronic
1183850547 22:40583539-40583561 CAGGCCATGGACTGGGGGTTGGG - Intronic
951766184 3:26202279-26202301 CAGAACCTGGACTGGCAGTCAGG + Intergenic
953969371 3:47335114-47335136 CAGAGCAAGGACTAGAACTTGGG + Intronic
955045628 3:55357331-55357353 CAGTTCATGGCCTTGGAGTTGGG - Intergenic
958675660 3:97265529-97265551 CAGAGCAAGGACCAGGAGTAGGG + Intronic
958889020 3:99762786-99762808 CAGAGCATGGTCGAGGAGTGTGG + Intronic
960634322 3:119768447-119768469 CAGAACATGCACCAGGAGTGGGG + Intergenic
960728907 3:120702500-120702522 CAGGCCATGGACCAGGGGTTGGG + Intronic
961708313 3:128807080-128807102 CTGAAAATGGGCTAGGGGTTGGG + Intronic
962170425 3:133095866-133095888 CAGTCCATGGCCTAGGGGTTTGG + Intronic
962445540 3:135460406-135460428 CAGAGCATGTACTCTGAGTTAGG + Intergenic
962626993 3:137235648-137235670 GAGAACATGGGGAAGGAGTTGGG + Intergenic
963047289 3:141112088-141112110 CAGAACCTGGGCTAGGACTGTGG + Intronic
963693899 3:148540586-148540608 CAGAAAATGGAGCTGGAGTTGGG + Intergenic
965333805 3:167410256-167410278 TAGAACTTGGACTTGCAGTTTGG - Intergenic
965980596 3:174685446-174685468 CAGAAAATGGAAGAGAAGTTTGG - Intronic
967409375 3:189152013-189152035 CAGAACCTGGAATAGGAGTATGG + Intronic
970054494 4:11955212-11955234 TAGAACAGGGACTAGCAGTTAGG - Intergenic
970735092 4:19156848-19156870 CAGAACAGAGTCTGGGAGTTGGG - Intergenic
972124167 4:35741992-35742014 CAGCACATAGTCCAGGAGTTGGG + Intergenic
974401754 4:61417160-61417182 CAGTACGTGGCCTAGGGGTTGGG + Intronic
976203631 4:82603672-82603694 CACAAACTGGACTAGGAGTCAGG - Intergenic
977664681 4:99632289-99632311 CAGAAAATGTAATAGGAGCTGGG - Intergenic
977789422 4:101081390-101081412 CAGAACATGCACAAGAACTTTGG + Intronic
979055991 4:115995194-115995216 CAGTCCATGGCCCAGGAGTTGGG + Intergenic
982566161 4:156989506-156989528 TAGAACATGGAATAGAAGTGAGG + Intergenic
983457847 4:167986448-167986470 CATAGCATGGACTAGGATGTTGG + Intergenic
983861791 4:172716326-172716348 CATAACATGGACTGGGTTTTGGG - Intronic
987202598 5:15592193-15592215 TAGAACGTGGCCTAGGATTTAGG + Intronic
987312290 5:16692465-16692487 CTGAACAATGACTGGGAGTTTGG + Intronic
988498950 5:31768098-31768120 CAGAACTGGGACCTGGAGTTAGG + Intronic
988695415 5:33616977-33616999 AAGAACATGGACTTGGAGGTTGG + Intronic
990645774 5:57842830-57842852 CCGAACATCCACTATGAGTTGGG + Intergenic
991998081 5:72408083-72408105 CAGAGCATGGACTAAGAGTTAGG + Intergenic
992673035 5:79078597-79078619 CACAACATGGGCTAGGTGTGAGG + Intronic
993554025 5:89313277-89313299 AAGAGCATGGTCTAGGAGCTGGG + Intergenic
994711370 5:103268764-103268786 CACAACATGGACTTGGAGCCAGG + Intronic
997360055 5:133289266-133289288 CAGAAGAAGGATTAGGAGTGGGG - Intronic
997670465 5:135667105-135667127 CAGAACATGAAATAGGAGATTGG - Intergenic
997689397 5:135815456-135815478 CAGTCCATGGCCTAGGGGTTGGG + Intergenic
999528379 5:152433874-152433896 CAGACCTTAGAATAGGAGTTAGG + Intergenic
1000042121 5:157492689-157492711 TTAAAAATGGACTAGGAGTTAGG - Intronic
1000603980 5:163308313-163308335 CAGACCATGGTCCCGGAGTTGGG + Intergenic
1001658240 5:173370656-173370678 CAGCACGTGGACTGAGAGTTGGG - Intergenic
1001853953 5:174994725-174994747 CAGAACTTGGAATATGTGTTTGG + Intergenic
1002566638 5:180115922-180115944 CAGAACCTGCACTAGGACTGGGG - Intronic
1006822513 6:36909033-36909055 CAGAACATGACCTTGGAGATAGG - Intronic
1010065179 6:71674095-71674117 CAGAAAATTGCCGAGGAGTTAGG + Intergenic
1010506757 6:76670152-76670174 CAGATCATGGTCTCGGATTTAGG - Intergenic
1010897006 6:81377143-81377165 CAGAAAATGAAACAGGAGTTTGG + Intergenic
1011224164 6:85088594-85088616 CCAAACATGGATAAGGAGTTTGG + Intergenic
1012186128 6:96219337-96219359 CAGAACATGGCATAGAAGGTAGG + Intergenic
1012283709 6:97362666-97362688 CAGAACAGGTACAAGGAGTTTGG + Intergenic
1012411205 6:98959584-98959606 AAGAACATGGAATAGAAGTGTGG - Intergenic
1012418875 6:99039814-99039836 CAGCACATGGGTTAGGATTTAGG + Intergenic
1013254303 6:108369380-108369402 CAGAACAAAGACTAGAACTTAGG + Intronic
1014344416 6:120250199-120250221 CAGAAGATGGACCAGGATTTAGG + Intergenic
1015508544 6:134014367-134014389 CAGTCCATGGTCCAGGAGTTGGG + Intronic
1015664003 6:135606672-135606694 GAGAAGCAGGACTAGGAGTTAGG - Intergenic
1015830775 6:137366273-137366295 CAGAAAATGGACTTGCAGATGGG - Intergenic
1016962784 6:149689300-149689322 CAGGCCATGGACAAGGAATTTGG + Intronic
1017806203 6:157947615-157947637 CAGAACTGGGGCTAGGAGGTAGG + Intergenic
1020488335 7:8747206-8747228 CAGAACCTGGACTGGGATTCAGG + Intronic
1021299736 7:18957826-18957848 CAGAACCTGGGCTAGAAGGTGGG - Intronic
1021361349 7:19716674-19716696 CAGAAGTTGGAGTTGGAGTTGGG - Intergenic
1023834517 7:44060417-44060439 CAGAACATGGACTCTGAGCAGGG + Intronic
1024904679 7:54362947-54362969 GAGAACCTGGACTAGGAGACTGG - Intergenic
1026272520 7:68849145-68849167 CAGAACAAGAACTTGGACTTAGG - Intergenic
1029983444 7:104900462-104900484 CAGAAAATGGCCTAAGAGTCAGG - Intronic
1030210525 7:106991242-106991264 CAGACCTTGGACTGGGAGCTGGG - Intergenic
1030342694 7:108398635-108398657 CTGAAAGTGGAATAGGAGTTAGG - Intronic
1031707062 7:124994391-124994413 CAGAAAATGGACTAAGATATTGG - Intergenic
1032455865 7:132072965-132072987 GAGAACAAGGTCTAGGAGTGGGG - Intergenic
1032805768 7:135352810-135352832 CAGGAGATGGAATAGGAATTTGG - Intergenic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1035028868 7:155844563-155844585 CAGAACATGCACCAAGAGTTCGG + Intergenic
1035173529 7:157034018-157034040 CAGAAGAGGAACTAGGACTTGGG + Intergenic
1038249565 8:25890485-25890507 CAGAACATGGGTTTGGAGTCAGG + Intronic
1038325678 8:26571146-26571168 GAAAACATGGACTAGGAGGAAGG - Intronic
1038628026 8:29213218-29213240 AAGAACATGGCTTAGGAGCTAGG + Intronic
1040676574 8:49757593-49757615 CAGGACCAGGTCTAGGAGTTGGG - Intergenic
1041930781 8:63284322-63284344 CAGTCCATGGCCTGGGAGTTGGG - Intergenic
1042640298 8:70926810-70926832 CAGACTATAGACTAGGAGTCAGG + Intergenic
1042658581 8:71129088-71129110 CAGAACATTAACCATGAGTTAGG - Intergenic
1042853624 8:73241600-73241622 CAGAACCTGGAGGAGGAGGTGGG + Exonic
1042879915 8:73475803-73475825 CAGAATATGGACTAGAATTCAGG + Intronic
1043697826 8:83242720-83242742 CAGTCCATGGCCTGGGAGTTGGG + Intergenic
1045680977 8:104659500-104659522 CATCACATGGACTTAGAGTTGGG - Intronic
1046021450 8:108670297-108670319 CAGAACATTGAGTAGGCATTGGG + Intronic
1046462167 8:114554030-114554052 CAGAAAATGAACTAGGGATTTGG + Intergenic
1047141744 8:122148512-122148534 CAGAACCTGGAATTGAAGTTTGG - Intergenic
1048046904 8:130781224-130781246 CAGAGCATGGACCAGAAGTCAGG + Intronic
1048216152 8:132497603-132497625 CAGAGAATGGACTAGCAGTGGGG - Intergenic
1048651972 8:136487869-136487891 CAGAACATGAAGTGGGAGGTGGG + Intergenic
1050753523 9:8970033-8970055 AGGAAATTGGACTAGGAGTTAGG + Intronic
1050905780 9:11003531-11003553 CAGAATTTGGAGTAGAAGTTGGG + Intergenic
1050933743 9:11366677-11366699 CTGAACATGTGGTAGGAGTTTGG + Intergenic
1052142389 9:25003706-25003728 GAGCACATAGTCTAGGAGTTGGG - Intergenic
1052589767 9:30476937-30476959 CAGACCATGGACTAGTACCTTGG + Intergenic
1053099529 9:35359535-35359557 CAGAAGAAGGATCAGGAGTTTGG - Intronic
1053387101 9:37701414-37701436 CAGAAGACTGAGTAGGAGTTGGG + Intronic
1053471007 9:38346209-38346231 CAGAACATGGACTGGGGGGAGGG - Intergenic
1053787464 9:41662914-41662936 GAGAACATGGTCAAGGAGTTGGG + Intergenic
1054157662 9:61651853-61651875 GAGAACATGGTCAAGGAGTTGGG - Intergenic
1054175740 9:61874253-61874275 GAGAACGTGGTCAAGGAGTTGGG + Intergenic
1054477436 9:65582858-65582880 GAGAACATGGTCAAGGAGTTGGG - Intergenic
1054661799 9:67706557-67706579 GAGAACGTGGTCAAGGAGTTGGG - Intergenic
1056275090 9:84986559-84986581 CAGTCCATGGCCTGGGAGTTGGG + Intronic
1058507423 9:105680327-105680349 CAGTTCATGGACTTGGATTTGGG + Intergenic
1060545323 9:124455944-124455966 CAGAACTGGGACTAGGACATGGG + Intronic
1060604985 9:124905622-124905644 CAGAAAATGGAATAAGAGGTGGG + Intronic
1061161203 9:128895456-128895478 GAGAGCAAGGACTTGGAGTTTGG - Intronic
1061457753 9:130711756-130711778 CAGAACATGGATTATTTGTTAGG + Intergenic
1185723504 X:2401043-2401065 CAGAAGAGGGACTAGCTGTTTGG - Intronic
1188974641 X:36658469-36658491 CAAAACTTGGACAAGGAGCTTGG + Intergenic
1192593333 X:72380424-72380446 CAGAATATGGACTAGAATGTTGG - Intronic
1194561885 X:95431600-95431622 CATACCATGGCCTAGGAATTGGG + Intergenic
1196055474 X:111350538-111350560 AAGGACATGGACTAGAACTTGGG + Intronic
1197492781 X:127139281-127139303 CAGAAACTGGAGTACGAGTTGGG + Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198082658 X:133253765-133253787 AAGAACAGGGAGTAGAAGTTTGG - Intergenic
1198431056 X:136566669-136566691 GAGAACCTGGACTGAGAGTTAGG + Intergenic
1198487848 X:137106312-137106334 CAGTACATGCACTAGGAGGCAGG + Intergenic
1198804790 X:140483605-140483627 TGGAGCATGGACTAGGACTTGGG - Intergenic
1199034661 X:143035513-143035535 CAAAACATGGACCAGAAGGTGGG - Intergenic
1199092682 X:143710529-143710551 CAAAACATGGACCAGAAGGTGGG + Intergenic
1200596331 Y:5145935-5145957 CAGTCCATGGCCCAGGAGTTGGG - Intronic
1200865134 Y:8035429-8035451 CAGAACAGGGCCTAGGAATGAGG + Intergenic
1200902086 Y:8443052-8443074 CAGAACAGGGCCTAGGAATGAGG - Intergenic
1202253043 Y:22892732-22892754 CAGAACAGGGCCTAGGAATGAGG - Intergenic
1202406033 Y:24526481-24526503 CAGAACAGGGCCTAGGAATGAGG - Intergenic
1202464747 Y:25143600-25143622 CAGAACAGGGCCTAGGAATGAGG + Intergenic