ID: 903764873

View in Genome Browser
Species Human (GRCh38)
Location 1:25727703-25727725
Sequence CCACACTCCCTGCCCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 291}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903764873_903764877 -8 Left 903764873 1:25727703-25727725 CCAGTTCTGGGCAGGGAGTGTGG 0: 1
1: 0
2: 2
3: 37
4: 291
Right 903764877 1:25727718-25727740 GAGTGTGGGATGCTTAGGAGCGG 0: 1
1: 0
2: 1
3: 20
4: 238
903764873_903764878 -7 Left 903764873 1:25727703-25727725 CCAGTTCTGGGCAGGGAGTGTGG 0: 1
1: 0
2: 2
3: 37
4: 291
Right 903764878 1:25727719-25727741 AGTGTGGGATGCTTAGGAGCGGG 0: 1
1: 0
2: 0
3: 13
4: 180
903764873_903764881 23 Left 903764873 1:25727703-25727725 CCAGTTCTGGGCAGGGAGTGTGG 0: 1
1: 0
2: 2
3: 37
4: 291
Right 903764881 1:25727749-25727771 CTGAGCCTCAGCCACCCTCACGG 0: 1
1: 1
2: 3
3: 32
4: 351
903764873_903764880 0 Left 903764873 1:25727703-25727725 CCAGTTCTGGGCAGGGAGTGTGG 0: 1
1: 0
2: 2
3: 37
4: 291
Right 903764880 1:25727726-25727748 GATGCTTAGGAGCGGGGTACAGG 0: 1
1: 0
2: 0
3: 6
4: 69
903764873_903764879 -6 Left 903764873 1:25727703-25727725 CCAGTTCTGGGCAGGGAGTGTGG 0: 1
1: 0
2: 2
3: 37
4: 291
Right 903764879 1:25727720-25727742 GTGTGGGATGCTTAGGAGCGGGG 0: 1
1: 0
2: 0
3: 15
4: 361
903764873_903764882 24 Left 903764873 1:25727703-25727725 CCAGTTCTGGGCAGGGAGTGTGG 0: 1
1: 0
2: 2
3: 37
4: 291
Right 903764882 1:25727750-25727772 TGAGCCTCAGCCACCCTCACGGG 0: 1
1: 0
2: 4
3: 25
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903764873 Original CRISPR CCACACTCCCTGCCCAGAAC TGG (reversed) Intronic
901221694 1:7587127-7587149 CCCCACTCCCATCCCAGACCAGG + Intronic
901776721 1:11565270-11565292 CCACATTTCCTGCCCTGAGCTGG + Intergenic
902079479 1:13811492-13811514 CCACACACCCTCCCCAGGCCCGG - Intronic
902217668 1:14944868-14944890 CCTCCTGCCCTGCCCAGAACAGG - Intronic
902535565 1:17117835-17117857 CCCCACCCCCAGCCCTGAACTGG - Intronic
902604025 1:17558861-17558883 CCATTCTCCCTGCCCAGCCCAGG - Intronic
902689909 1:18104671-18104693 CCACCCTCCCTGCCAGGAAAGGG - Intergenic
902822970 1:18954811-18954833 CCACAATCTCTGGCTAGAACTGG - Intronic
903140759 1:21337902-21337924 CCACACTGCCTGCTCAGATGTGG + Intronic
903588967 1:24440025-24440047 CCACACTCCAGACCCACAACTGG - Intronic
903764873 1:25727703-25727725 CCACACTCCCTGCCCAGAACTGG - Intronic
903785503 1:25858811-25858833 GCCAACTACCTGCCCAGAACCGG - Intronic
903928506 1:26848864-26848886 CCAGACCCCCTGCCCAGCCCTGG - Intronic
904300530 1:29550745-29550767 CCACACTCACTGCCCCGGGCAGG - Intergenic
904326289 1:29728800-29728822 CCAAACTCCCTCCCCACAGCTGG + Intergenic
904457676 1:30657299-30657321 CCACACTCACTGCCCCGGGCAGG + Intergenic
906482203 1:46206434-46206456 CCAGACTCTCTGCCCAGCGCTGG - Intronic
908350477 1:63282101-63282123 CCACAATGCCTGTACAGAACAGG + Intergenic
910087130 1:83416983-83417005 CCACAATCCATGCCTAGAACAGG - Intergenic
911472193 1:98332634-98332656 CCACCCTCCCTGCCCAGACCTGG - Intergenic
913195697 1:116454497-116454519 CCAGTCTCCCTGCCCAGACAGGG + Intergenic
913346559 1:117816375-117816397 CCACACACCTTGCCAAGACCAGG - Intergenic
913424240 1:118709021-118709043 CCAAACACCCTCCCCACAACAGG - Intergenic
915005105 1:152628512-152628534 CCCCACTCCTGGGCCAGAACAGG - Intergenic
915490598 1:156248072-156248094 CCCCACTCCCCGCCCAGGCCTGG - Intronic
917370670 1:174290131-174290153 CCATACTCCCTGGCCAGACTGGG + Intronic
919115457 1:193275777-193275799 CCCCAGTACCAGCCCAGAACCGG - Intergenic
919348582 1:196418843-196418865 CCAAAACCCCTGCCCAGAAGTGG + Intronic
920022064 1:202963762-202963784 CCACACTCTCTGCCCTGTCCTGG + Intronic
920692247 1:208155721-208155743 CCACCCTCCCTGCCCAGCTCTGG + Intronic
922717956 1:227886809-227886831 CCAGACACCCTGTCCAGGACCGG + Intergenic
1063439315 10:6059650-6059672 CCACCCTCCCTGTCCAGGGCAGG + Intronic
1065263481 10:23951144-23951166 CCACTCTGCCTCCCCAGAATGGG - Intronic
1067097159 10:43309271-43309293 ACACACTCCTTGACCAAAACAGG - Intergenic
1067362397 10:45594663-45594685 CCACACCCCCTGCCCGGGCCGGG + Intronic
1067705750 10:48605275-48605297 CCGCACTCCCTGCCAAGCCCGGG + Intronic
1067828998 10:49599126-49599148 CCAGACTCCCTGCACAGAGATGG - Intergenic
1068776425 10:60872913-60872935 CCCCATTCCCTCCCCAGACCTGG + Intronic
1069752172 10:70751791-70751813 CCAAAGGCCCTGCCCAAAACGGG - Intronic
1070666387 10:78348049-78348071 CCACACTCCCTCCCAAGTAGTGG + Intergenic
1070746565 10:78937225-78937247 CTCCCCTCCCTGCCCAGGACAGG - Intergenic
1070760508 10:79021461-79021483 TCACACTCCCCGCCCAGATTTGG + Intergenic
1071894563 10:90051519-90051541 CCACAATCCCTGCCCAGGAAGGG + Intergenic
1073331345 10:102671871-102671893 CAGCACTCCCTGCCCAAAAAAGG - Intergenic
1073445878 10:103580045-103580067 CCAGACTCCCTGCCCAGGGCTGG + Intronic
1074130310 10:110567941-110567963 CCACAGTCCCCGCCCAGCCCTGG - Intronic
1075414044 10:122249457-122249479 CCACTCTCCCTGCCTGGACCTGG + Intronic
1075611194 10:123856040-123856062 GCACACTCCCTGCACAGCTCTGG - Intronic
1075611209 10:123856166-123856188 CCACAATTCCTGCCTATAACTGG - Intronic
1075920039 10:126203817-126203839 CCACACTCCCAACACAGAACTGG - Intronic
1076630014 10:131846770-131846792 CCAGAGTCCCAGCCCAGACCCGG - Intergenic
1076733121 10:132447988-132448010 CCACAGGCCCAGCCCAGAACTGG - Exonic
1076757029 10:132577872-132577894 CCACACTCCCTTCTCAAACCAGG - Intronic
1077299443 11:1840317-1840339 CCACGCTCCCTGGCCAGGTCAGG - Intronic
1077390413 11:2298468-2298490 CCACACTCCCTGTGCAGACAAGG - Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079719308 11:23790244-23790266 CCACACTCCCTGCACGCAAAGGG - Intergenic
1080650064 11:34215175-34215197 CCTCACCCCCTGCCCAGCAATGG - Intronic
1082805403 11:57446231-57446253 TCACACTCCTTGCCCAAGACTGG + Intergenic
1083267023 11:61551509-61551531 CCTCCCTACCTCCCCAGAACAGG + Intronic
1083477077 11:62921630-62921652 CCACACCCACTGCACAGACCCGG + Exonic
1083596557 11:63920568-63920590 CCACACTCCCTCCCCAACCCCGG - Intergenic
1089110845 11:116054736-116054758 CCACACTGCCCACCCAGAACTGG - Intergenic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1090441231 11:126727247-126727269 CCACTCTCCCTGCACAGAGCAGG + Intronic
1091857366 12:3750787-3750809 CAACCCTCCCTCCCCACAACAGG + Intronic
1092484758 12:8893022-8893044 CCACACTCCCTGCCCTTCCCAGG + Intergenic
1094247317 12:28313738-28313760 CTACACACCCTGGACAGAACAGG - Intronic
1094391956 12:29961223-29961245 ACACACTCCTGGCACAGAACTGG + Intergenic
1096100510 12:48968115-48968137 CCCCACTCTCTGCCCAGCCCTGG - Exonic
1096189218 12:49604265-49604287 CCACACTCCCCTCCCAGAGGAGG + Intronic
1096496005 12:52039865-52039887 CCATTCCCTCTGCCCAGAACTGG - Intronic
1097507763 12:60497730-60497752 CCCCACTCCCACCCCACAACAGG - Intergenic
1098588377 12:72182770-72182792 CTACACTTCCTTCCCTGAACAGG - Intronic
1101880145 12:108620829-108620851 CACCACGCCCGGCCCAGAACTGG - Intergenic
1102149402 12:110678284-110678306 CCAAACTCCCTTCCCAGCATGGG - Intronic
1105599966 13:21877983-21878005 ACACACTCCCTGCACATGACAGG - Intergenic
1106583840 13:31039726-31039748 CCACACTCCATCTCCAGCACTGG - Intergenic
1108447861 13:50527244-50527266 CAACCCTTCCTGCACAGAACAGG - Intronic
1110264706 13:73524149-73524171 CCATGCTCCCTGCCCAAAAGTGG - Intergenic
1113800518 13:113084022-113084044 CTACACTGACTGCCCAGAACTGG + Exonic
1118477354 14:66130343-66130365 CCACCCCACCTGCCCAGAAGGGG - Intergenic
1118713949 14:68546077-68546099 CCAGACTTTGTGCCCAGAACTGG - Intronic
1118857850 14:69637826-69637848 CCACACTCCCTCCCCTGCACAGG - Intronic
1119150050 14:72350505-72350527 TCACAATCCTTGGCCAGAACTGG - Intronic
1120012652 14:79434939-79434961 CCTCAGTCCCTCTCCAGAACCGG - Intronic
1120835625 14:89036237-89036259 CCAGACTCCCTGCCGAGGTCTGG - Intergenic
1122699995 14:103581916-103581938 CCACCCTCCCTCCACAGAGCAGG - Intronic
1123500505 15:20877572-20877594 CCCCCCTCCCTGCCCAGGCCTGG - Intergenic
1123557750 15:21451265-21451287 CCCCCCTCCCTGCCCAGGCCTGG - Intergenic
1123593977 15:21888546-21888568 CCCCCCTCCCTGCCCAGGCCTGG - Intergenic
1124003806 15:25780418-25780440 TCACACTCCCGGCACAGACCTGG + Intronic
1125925756 15:43561655-43561677 CAAAACTCCCAGACCAGAACTGG + Intronic
1125938900 15:43661206-43661228 CAAAACTCCCAGACCAGAACTGG + Intronic
1126724628 15:51619836-51619858 CCACACACCCTCTCCAGAGCAGG + Intronic
1127732619 15:61814519-61814541 CCCCACCCCCTGCCCAGTCCAGG - Intergenic
1127997007 15:64158961-64158983 CCACCCTCACTGTACAGAACAGG + Intronic
1128354029 15:66911732-66911754 CAGCACTCCCTGCCCAGCTCTGG - Intergenic
1129464480 15:75716312-75716334 CCACAGCCACTGCCCAGAGCGGG - Intergenic
1129616606 15:77103960-77103982 TCACACTCTCTGCCCACATCAGG + Exonic
1129720767 15:77876700-77876722 CCACAGCCACTGCCCAGAGCGGG + Intergenic
1129966158 15:79737691-79737713 ACCCACTCTCTGCTCAGAACCGG + Intergenic
1129975134 15:79815635-79815657 CTCCACTCCCTGCCCTGAAAGGG + Intergenic
1130411649 15:83653574-83653596 CCACCCACCCCGCCCAGACCCGG - Intergenic
1131922910 15:97349887-97349909 CTGGACTCCCTGCCCAGAAGGGG + Intergenic
1202966100 15_KI270727v1_random:178437-178459 CCCCTCTCCCTGCCCAGGCCTGG - Intergenic
1132731955 16:1367063-1367085 CCCCTCACCCTGCCCAGAGCAGG + Intronic
1133799960 16:9077123-9077145 CTACACTCTCTGACCACAACCGG - Intergenic
1134125378 16:11612659-11612681 CCCCACTCCCAGCCCAGAACTGG + Intronic
1135230671 16:20703807-20703829 CCACAATGTCTGGCCAGAACTGG + Intronic
1136395574 16:29990983-29991005 CCACCCTCCCTCCCCAGTCCTGG - Intronic
1136631196 16:31490180-31490202 CCTCACTCCCTGTACAGAATGGG + Exonic
1136654650 16:31702709-31702731 CAACACTCCCAGCTCAGGACTGG + Intergenic
1137769468 16:51004468-51004490 CCACACTCCCTGCCTTGACTGGG + Intergenic
1139488289 16:67271607-67271629 CCCAACTCCCTCCCCAGCACTGG + Exonic
1139588060 16:67916954-67916976 CCCCACTCCCTGCACACCACAGG + Intronic
1139659527 16:68411332-68411354 CCACACTGCCTGGCCAGAGCTGG + Intronic
1140896236 16:79327063-79327085 TCACAGCCCCAGCCCAGAACAGG + Intergenic
1141343046 16:83221215-83221237 CCAAACTCCCTTCCCAGCCCCGG - Intronic
1141442956 16:84041251-84041273 CCACACTCCCCACACAGAGCCGG - Intronic
1142276049 16:89119405-89119427 ACACCCTCCCTCCCCAGACCTGG - Intronic
1142759766 17:2035513-2035535 CCCCACTCCCTCCCCACCACAGG - Intronic
1143108042 17:4539177-4539199 CCAGGGTCCCAGCCCAGAACCGG + Intronic
1143544536 17:7588603-7588625 CTACCCTGTCTGCCCAGAACTGG - Intronic
1143746157 17:8995723-8995745 CCAGACTCCCTGGCCTGAAAAGG - Intergenic
1144221571 17:13104666-13104688 CACCACGCCCTGCCCAGACCTGG + Intergenic
1145916474 17:28576961-28576983 CCACACCCCCTCCCCAGGACTGG + Exonic
1145966018 17:28917835-28917857 CCACACTCCCTTCCCAGGAAGGG + Intronic
1145974141 17:28974709-28974731 CCCCAGGCCCTCCCCAGAACTGG + Intronic
1146256196 17:31392470-31392492 GCACACACCCTGCCCAGACACGG + Intronic
1146258200 17:31403987-31404009 CCTCCCTCCCTGCCCAGTGCTGG - Intronic
1146369814 17:32258576-32258598 TCACACTGCCTGCCCAGATGCGG - Intergenic
1146530971 17:33607418-33607440 CCACACTCCCTGCACTGATTTGG + Intronic
1146674120 17:34761158-34761180 CCACCCTCCCTGCCTGGACCTGG - Intergenic
1147212202 17:38878187-38878209 CCCAGCCCCCTGCCCAGAACAGG - Intronic
1148443082 17:47721727-47721749 CCTCACTTCCAGCCCGGAACAGG + Intergenic
1148862662 17:50612730-50612752 CCTCCCTCCCTGCCCCGAAGTGG + Intronic
1149988546 17:61367056-61367078 ACACACTCCCTGCCAATGACAGG - Intronic
1150130120 17:62664638-62664660 CCAGCCTCCCTGCCCAGCGCTGG + Exonic
1150267003 17:63838288-63838310 CCCCACCCACAGCCCAGAACTGG + Intronic
1151376775 17:73694629-73694651 ACCCACTCCCTCCCCAGGACAGG - Intergenic
1151578486 17:74964428-74964450 CCACCCTCCCAGCCCACAGCAGG - Intronic
1151667987 17:75556512-75556534 CCTCACCCCCTGCCCGGGACTGG - Intronic
1151986923 17:77549479-77549501 CCACAGTCCCTGCACTGTACAGG - Intergenic
1152001106 17:77645814-77645836 CCACCCCCCCTGCCCAGCAGTGG + Intergenic
1152366417 17:79859181-79859203 CCTCACTCCCTCCCCTGAAAGGG - Intergenic
1152791550 17:82282943-82282965 CCACCCTCCCTGCGCAGGGCTGG + Intergenic
1152931506 17:83112373-83112395 CCACATCCCCAGCCCAGGACAGG - Intergenic
1153718603 18:7877910-7877932 TCACACTCCTTGCCAAGAGCAGG - Intronic
1154344821 18:13532888-13532910 CCACGGCCCCTGCCCAGGACAGG - Intronic
1157298011 18:46459729-46459751 CCAGACTCCCTGACCAGTGCCGG - Exonic
1157724468 18:49953193-49953215 CACCACTCCCTGTCCAGCACTGG + Intronic
1158926426 18:62267931-62267953 CCACACTCCCTCCCCAAAAAAGG + Intronic
1160508004 18:79437945-79437967 CCACCCTCCCTGGCCAGAGAAGG - Intronic
1160622109 18:80178893-80178915 CCTCACTCCCTCCCCAGAAGAGG - Intronic
1160696119 19:485355-485377 AAACACCGCCTGCCCAGAACAGG + Intergenic
1161619463 19:5290656-5290678 CCAGACTCCCGCCCCAGGACAGG - Intronic
1162515042 19:11142694-11142716 CCTGACTCACTGCCCAGCACTGG - Intronic
1163271705 19:16258526-16258548 CCACAGCCCCTGCCCAGGCCAGG + Intergenic
1163374751 19:16923163-16923185 CCACACTCCCAGCCCAGCCTTGG - Intronic
1163744917 19:19040565-19040587 CACCACTCCCTGCCAAGAGCTGG + Intronic
1164758962 19:30713747-30713769 CACCACGCCCTGCCCAGTACAGG - Intergenic
1164982131 19:32622011-32622033 CCACACTCGATGTCCAGAACTGG + Intronic
1165467983 19:35986368-35986390 CCACACTCACTGCCCATTCCTGG - Intergenic
1165638413 19:37363449-37363471 CCACACTCCCTGCACATAAAAGG - Exonic
1165638437 19:37363611-37363633 CCACACTCCCTGCACACATGAGG - Exonic
1167752446 19:51389059-51389081 CAACACTGCCTGCCCAGGATGGG - Exonic
1167759727 19:51438399-51438421 CAACATTCCCTGCCCTGATCAGG + Intergenic
1168349220 19:55666513-55666535 CCAGACTCAATGCCCACAACAGG - Intronic
926121891 2:10245766-10245788 CCCCACTCCCTGCCAAGGCCAGG - Intergenic
926427744 2:12754786-12754808 TCACACTTCCTTCCCAGAAGAGG - Intergenic
928412909 2:31068060-31068082 CCCCAAGCCCTGCCCAGAAAGGG + Intronic
930062803 2:47304844-47304866 CCAAACTGCATGCCCAGAAGCGG - Intergenic
931022003 2:58056560-58056582 CCACACTACCTAAGCAGAACAGG - Intronic
931838642 2:66126589-66126611 CCAAAGTCCCTGGCCAGCACAGG + Intergenic
931966925 2:67544975-67544997 CACCTCACCCTGCCCAGAACTGG - Intergenic
932089953 2:68797579-68797601 CCACACTTGCTTCTCAGAACGGG + Intronic
937346774 2:121130958-121130980 CCACAAACCCTGCCCAGGACAGG - Intergenic
937986875 2:127641946-127641968 CCACACTCCCAGCCCAGGGCGGG - Intronic
940344651 2:152616740-152616762 CCCCACTCCATGCCAAGAAAGGG - Intronic
940485614 2:154291683-154291705 CCACACCTCCTGGCCAGACCAGG + Intronic
942641548 2:178066490-178066512 TCCCACTGCCTGCCCAGGACTGG + Intronic
948219477 2:236258215-236258237 CCACACTGCCTTCCCAGGAGTGG - Intronic
948231492 2:236352218-236352240 CCAAACTCTCTGGCCAGCACAGG - Intronic
948604083 2:239123682-239123704 CCACAGTTCCAGCCCAGAAGAGG - Intronic
948728124 2:239947060-239947082 CCACACTACCTGCTGAGCACCGG - Intronic
948808092 2:240461544-240461566 CCACACCCCCTGCCCAGCAGGGG + Intronic
1169039842 20:2483969-2483991 CCACACTCCCTGCACAAATAAGG + Exonic
1169728946 20:8765964-8765986 CCACCATGCCTGCCCACAACTGG + Intronic
1170290815 20:14766196-14766218 CAGCACTCCCTGTCCAGAATTGG - Intronic
1170658713 20:18315656-18315678 CCACACTCCCTGCACACAATTGG - Exonic
1171148089 20:22803248-22803270 CTACTCTCCCTGCTCAGAGCAGG + Intergenic
1171510217 20:25676311-25676333 CCACACTCCTTGCACACAAAAGG + Exonic
1171510235 20:25676479-25676501 CCACACACCTTGCACAGAAAAGG + Exonic
1172215475 20:33232730-33232752 GCATGCTCCCTGCCCTGAACAGG - Intergenic
1173654482 20:44690217-44690239 CCAAACTGCCTCCCCAGGACAGG + Intergenic
1175901436 20:62361399-62361421 CCTCACTGCCTGCCCAGCCCGGG + Intronic
1176093019 20:63327313-63327335 CCAAGCTCCCAGCTCAGAACAGG - Intronic
1178484803 21:33012250-33012272 CCCCATTACCTCCCCAGAACGGG - Intergenic
1178690076 21:34743267-34743289 CCACATCCCCTACCCACAACAGG + Intergenic
1179192810 21:39137535-39137557 CCGCTCTCCCTCCCCAGAAATGG - Intergenic
1179529607 21:42009826-42009848 CCCCAACCCCTGCCCGGAACAGG + Intronic
1179939578 21:44628922-44628944 CCACCCACCCAGCCCAGCACAGG - Intronic
1180001337 21:44996845-44996867 TGAGACTCCCTGCCCAGGACTGG + Intergenic
1180898439 22:19353905-19353927 GCACAGTCCCTGCCCAGGCCTGG - Intronic
1181806881 22:25380290-25380312 CCACACCCCCTGCCTAGGCCAGG + Intronic
1183091849 22:35527674-35527696 TCACTCTCGTTGCCCAGAACTGG + Intergenic
1183230763 22:36580499-36580521 CCACACTCCATAGCCAGAAGTGG - Intronic
1183456560 22:37926095-37926117 CCACACCCCCTCCCCAGGCCCGG - Intronic
1183750770 22:39719185-39719207 TCACACTCCCTGCCCAGGGCGGG + Intergenic
1183987749 22:41578673-41578695 CCACCCTCTCTGCCCTGAGCCGG + Intronic
1184241591 22:43213975-43213997 CCACACTCTCTGGCCACACCAGG + Intronic
1184415394 22:44349218-44349240 CCTCGCTCCCTGGCCAGCACAGG + Intergenic
1185016474 22:48346144-48346166 CCACAAACGCTGCCCAGAATGGG + Intergenic
1185063053 22:48616992-48617014 CCACGCTCCCAGCCCAGCCCTGG - Intronic
1185147610 22:49147791-49147813 CCAAAGTCCCTGCCCAGCTCGGG + Intergenic
1185397804 22:50601401-50601423 CCAGACTCTCTTCCCAGAGCAGG + Intronic
950304751 3:11909344-11909366 GCGCCCTCCCTGCGCAGAACGGG + Intergenic
950507780 3:13406409-13406431 ACACAGTCCCTGACCAGTACAGG + Intronic
951206727 3:19933615-19933637 CCACACACCCTGCCCAAAGGAGG + Exonic
951960247 3:28310202-28310224 GCACCCTCCCTGCCCAGAGCAGG + Intronic
952722069 3:36544132-36544154 ACACACTCCCTGCTCATCACTGG + Intronic
953771228 3:45779922-45779944 CCACACCCCCTTCCCCGAGCGGG + Intronic
954391698 3:50271016-50271038 CCTCCCTCCCTGCCTAGATCCGG - Intronic
954712811 3:52513350-52513372 CCCCTCGCCCTGCCCAGAGCCGG + Intronic
955699166 3:61666398-61666420 CCACACACCCTTCCCAGAAGGGG - Intronic
958784674 3:98584771-98584793 CCAGGCTCACTGCACAGAACAGG + Intronic
960559497 3:119067768-119067790 CCTCAATCCATGCCTAGAACAGG + Intronic
961081996 3:124034629-124034651 ACACAGTCCCTCCCTAGAACCGG + Intergenic
961456804 3:127028519-127028541 CCAGAGTCTCTGCCCAGAGCAGG - Intronic
961785981 3:129347191-129347213 GCGCCCTCCCTGCACAGAACGGG + Intergenic
962803780 3:138912642-138912664 CCACCCTCAGTGCCCAGGACAGG - Intergenic
963526992 3:146427521-146427543 CCTCCCTCCCTGCCCAGCACCGG + Intronic
967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG + Exonic
967291765 3:187927752-187927774 CCACAGTCCAGCCCCAGAACTGG - Intergenic
968000756 3:195204621-195204643 CCACAGTCCCTGCACAGACCAGG - Intronic
969238273 4:5882834-5882856 CAACTCTCCCTGTCCAGAAAAGG + Intronic
969311348 4:6354505-6354527 ACACACGACCTGCCCAGAGCTGG + Intronic
971862916 4:32131319-32131341 CCCCACTCCACACCCAGAACAGG + Intergenic
973257747 4:48129966-48129988 CCACACTCCCTGCCCACCGAGGG - Intronic
973863163 4:55085777-55085799 CCACACTCCCAGCACAGGCCTGG - Intronic
979615075 4:122733140-122733162 CCAGAATCCCTGCCCAAAACAGG - Intronic
980023848 4:127740840-127740862 CCACAATCTCTGCACAGAAAGGG + Intronic
983454043 4:167940491-167940513 CTAACCTCCCTGCCAAGAACAGG + Intergenic
983785034 4:171719430-171719452 CCACACTCGCTCCCCAGAAATGG + Intergenic
984858623 4:184217543-184217565 CTCCCCTCCCTGCCCAGAAGAGG + Intronic
985646552 5:1087504-1087526 CCACACGCACTGCTCAGAGCAGG - Intronic
985997823 5:3606506-3606528 CCCCCCTCACTGCCCAGAAAGGG - Intergenic
987411185 5:17616249-17616271 GCACAGACCATGCCCAGAACAGG + Intergenic
988630492 5:32925815-32925837 CCACAGTGTCAGCCCAGAACGGG - Intergenic
988989662 5:36658006-36658028 GCACATTGCCTGCCCAAAACAGG - Intronic
989105487 5:37859123-37859145 CCACCATCCCTGGCCAGAAGAGG - Intergenic
990859831 5:60314634-60314656 CCACACCCCCACCCCACAACAGG + Intronic
991543282 5:67752797-67752819 CCACACTACCTCCCCAGTAATGG + Intergenic
993413631 5:87600655-87600677 CCACTCCCCCTGCTCATAACTGG - Intergenic
994329166 5:98486236-98486258 CCACATCCCCTGCCCAAAAGGGG + Intergenic
998165088 5:139838257-139838279 CCCCGCTGCCTGCCCAGCACTGG - Intronic
998393647 5:141804220-141804242 CCACACTCCTTGCCCCGACCAGG - Intergenic
998694485 5:144623960-144623982 CCCCACTCCCACCCCAAAACAGG + Intergenic
999283425 5:150379760-150379782 CAACACTCACTCCTCAGAACGGG + Intronic
999395979 5:151228322-151228344 TCACACTACGTGTCCAGAACGGG + Intronic
999771906 5:154782443-154782465 CCACTCTCCCCGCCCAGATGTGG - Intronic
1001382883 5:171315549-171315571 CCTCACTCCCTGCCCGGACCGGG - Intergenic
1002445824 5:179289138-179289160 CCACACTCCCTGCTCAGAGACGG + Intronic
1007397390 6:41585548-41585570 CCTCACCCCCTGCCCAGAGCTGG + Intronic
1007465513 6:42048714-42048736 CCCCACTTCCTGCCCAGCTCTGG - Intronic
1011521209 6:88208948-88208970 CCACACTCCCTCCCCACGATGGG + Intergenic
1011954220 6:93005216-93005238 CCACACTCCTTGGCCAGCAGAGG + Intergenic
1013811162 6:114046110-114046132 CCACACTGCCTGAACAGAATTGG + Intergenic
1017811858 6:157989568-157989590 CCACACCCTCTGCTCAGAAAGGG - Intronic
1018933116 6:168255151-168255173 ACAAACTCCCTCCCCAGAAGAGG - Intergenic
1019697045 7:2451802-2451824 CCCCACGGCCTGTCCAGAACCGG - Intergenic
1019818076 7:3215979-3216001 CCACACCACCTGCCGAGAAGTGG - Intergenic
1020479271 7:8637544-8637566 CCAGCCTCACTGACCAGAACAGG - Intronic
1020970510 7:14931896-14931918 CCACACTCACTTCTCAGAACTGG + Intronic
1021677671 7:23097448-23097470 CCACAGACTCTACCCAGAACTGG - Intergenic
1023302808 7:38792019-38792041 CCAGACTGCCTGGCCAGAGCTGG + Intronic
1023969903 7:44983175-44983197 CCACAGCCCAGGCCCAGAACTGG + Intergenic
1023996003 7:45159212-45159234 TCACGCTCCCTGGCCAGAATAGG + Intronic
1024521109 7:50304603-50304625 CCACACTCCCCGCCCCCAGCCGG - Intronic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026561685 7:71455681-71455703 CCACACTCCCCAGCCAGCACGGG + Intronic
1026867008 7:73830211-73830233 CCAGCCTGCTTGCCCAGAACTGG - Exonic
1027304008 7:76873468-76873490 CCACAATCCATGCCTAGAATAGG - Intergenic
1027486556 7:78769060-78769082 CTCCACTCCCTGCTCAGTACAGG + Intronic
1027699284 7:81449736-81449758 CCCCACTACCAGCCCAGAGCTGG + Intergenic
1028486373 7:91362391-91362413 CCCCACTCCCTGCCCCCGACAGG - Intergenic
1029456722 7:100675508-100675530 CCTCCCGCCCTCCCCAGAACCGG - Intronic
1029884177 7:103849656-103849678 CTACTCTCCCTGCATAGAACTGG + Intronic
1030065050 7:105652960-105652982 CAAGGCTGCCTGCCCAGAACCGG - Intronic
1030407592 7:109133547-109133569 CCACAATCTATGCCCAGAAAGGG - Intergenic
1031979405 7:128115077-128115099 ACGCACACCCTGCACAGAACTGG - Intergenic
1033348016 7:140540487-140540509 CCACCCTCCCTGCCCTGCTCTGG - Intronic
1034354916 7:150444283-150444305 TCAGTCTCCCTGCCCAGAGCCGG + Intergenic
1035712483 8:1729317-1729339 CCCCACTCTCTGCACAGCACAGG + Intergenic
1035842666 8:2829150-2829172 CCACCCACCCTCCCCAGAATGGG - Intergenic
1037920849 8:22804396-22804418 CCAGACTCCTTGCCCAGGCCTGG + Intronic
1037942036 8:22958920-22958942 CCACACTCTCTGGCCACAATTGG + Intronic
1041182459 8:55262992-55263014 CCACACGCCCTGCACAGCATTGG + Intronic
1042663237 8:71178683-71178705 CCTCACTTCCTGCCACGAACAGG + Intergenic
1046658966 8:116927967-116927989 GGGCAGTCCCTGCCCAGAACAGG + Intergenic
1046784625 8:118252741-118252763 CTACACTCACTGCCCATAATAGG - Intronic
1046983941 8:120366885-120366907 TCACACAGCCTGCCAAGAACTGG - Intronic
1048529347 8:135233609-135233631 CCACCCTCCCTGCCCCGCTCTGG + Intergenic
1049220217 8:141425580-141425602 CCCCACCCCCCGCCCAGACCTGG - Intronic
1052526702 9:29628085-29628107 CCACACTGTCTGCCATGAACTGG + Intergenic
1056692996 9:88823863-88823885 CCTCTTTCCCTGCCCAGATCTGG - Intergenic
1057210525 9:93198787-93198809 CCCCACTCCCTGCCCAGCTCTGG + Intronic
1058656345 9:107225015-107225037 TCACATTCACTGTCCAGAACTGG - Intergenic
1058793140 9:108471204-108471226 TCACTCTCCCTGCCCATAATTGG + Intergenic
1058962947 9:110008828-110008850 CCACACCCATTGGCCAGAACTGG - Intronic
1059051086 9:110926206-110926228 CACCACGCCCAGCCCAGAACTGG + Intronic
1060555910 9:124507121-124507143 GCACCTTCCCTGCCCAGAGCAGG + Intronic
1060820565 9:126659244-126659266 CCTCACCACCTGCCCAGCACTGG - Intronic
1060982594 9:127802552-127802574 CCTCAGTCTCTGCCCCGAACAGG - Intronic
1061451073 9:130667196-130667218 CCTCACCCCCAGCCCAGGACTGG - Intronic
1061861863 9:133472439-133472461 CCACACCCCCTACCCAGCGCTGG + Intronic
1062145889 9:134989470-134989492 CCACCCTCCCAGCCCAGTTCCGG - Intergenic
1062600121 9:137315799-137315821 CCCCACTCCCCGCCCAGACCCGG + Intronic
1062675798 9:137742901-137742923 CCAGCCTCCCTTCCCAGCACAGG - Intronic
1188034699 X:25304563-25304585 CCACACTACCTTCTCAGAACTGG - Intergenic
1189186853 X:39062235-39062257 CCTCACTCCCAGCCCAAGACTGG + Intergenic
1189344737 X:40232434-40232456 CCCCACCCCCTGCCCTGGACAGG - Intergenic
1192978984 X:76318750-76318772 CCACAGTACCAGCCCAGAGCTGG - Intergenic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1196268513 X:113682152-113682174 CCACACTCTCTACCCAGAAGGGG + Intergenic
1197043637 X:121970242-121970264 CCAGACTCCATGCCCAACACAGG + Intergenic
1198975749 X:142333621-142333643 CCACAATCTCTGCACAGAAAAGG - Intergenic
1199854033 X:151745108-151745130 CCTCACTCCCTGCCCTGGAATGG - Exonic
1201927860 Y:19309135-19309157 GCACACTACCTCCCCAGAAATGG + Intergenic
1202047228 Y:20747485-20747507 CCACACTCACAGCCCAGACATGG - Intergenic