ID: 903765322

View in Genome Browser
Species Human (GRCh38)
Location 1:25730448-25730470
Sequence CTGAGAATGACAAATACTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903765317_903765322 -4 Left 903765317 1:25730429-25730451 CCATCCTCGAAAACCTTAGCTGA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 903765322 1:25730448-25730470 CTGAGAATGACAAATACTAGGGG 0: 1
1: 0
2: 1
3: 16
4: 183
903765318_903765322 -8 Left 903765318 1:25730433-25730455 CCTCGAAAACCTTAGCTGAGAAT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 903765322 1:25730448-25730470 CTGAGAATGACAAATACTAGGGG 0: 1
1: 0
2: 1
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903765322 Original CRISPR CTGAGAATGACAAATACTAG GGG Intronic
900759674 1:4462415-4462437 CTGTGCATGGCACATACTAGGGG + Intergenic
902109006 1:14062229-14062251 CTGAGTATGACAAAAACGACGGG + Intergenic
903765322 1:25730448-25730470 CTGAGAATGACAAATACTAGGGG + Intronic
904406430 1:30292508-30292530 CTGACAATATCAAATGCTAGAGG + Intergenic
906267592 1:44445017-44445039 CTGACAATATCAAGTACTAGTGG - Intronic
907000104 1:50844028-50844050 CAGAAAATGACAAATGCTGGTGG - Intronic
911908941 1:103606835-103606857 CAGAGAATGAAAAATACTACAGG + Intergenic
911911257 1:103639131-103639153 CAGAGAAAGAAAAATACTACAGG + Intergenic
911913978 1:103672626-103672648 CAGAGAATGAAAAATACTACAGG - Intronic
911917197 1:103712819-103712841 CAGAGAAAGAAAAATACTACAGG - Intronic
911918672 1:103733269-103733291 CAGAGAAAGAAAAATACTACAGG + Intronic
911921787 1:103772317-103772339 CAGAGAAAGAAAAATACTACAGG + Intergenic
913322817 1:117601178-117601200 CTGAGAATGACACGTGTTAGGGG + Intergenic
916055912 1:161068948-161068970 AAGAGAATCACAAAGACTAGGGG + Intronic
918929004 1:190828765-190828787 TTGAGAAGAACAAATACTAATGG + Intergenic
919296254 1:195704635-195704657 CAGACAATGATAAATAATAGTGG - Intergenic
919477407 1:198046074-198046096 ATTAGAATGATAAATACCAGAGG - Intergenic
921555930 1:216599106-216599128 CAGAAAATGAAAAATATTAGAGG + Intronic
921903491 1:220472743-220472765 AATAGAATGACAGATACTAGAGG - Intergenic
922451378 1:225740347-225740369 CTGAGAATGACAAAGTCAAACGG - Intergenic
924386252 1:243500601-243500623 CTGAGAATGACAAACACTAAAGG + Exonic
1068489983 10:57710949-57710971 CTCAGAGTGACAAATACCATAGG + Intergenic
1071324875 10:84503272-84503294 CTGAGAAGGAAAAATAATAAAGG - Intronic
1073741427 10:106412056-106412078 CTGAGAAAGAAAAATAGTAAAGG + Intergenic
1074599836 10:114902321-114902343 ATGAGAATGGCAAATATTTGTGG - Intergenic
1079398339 11:20085231-20085253 CTGAGAAGAGTAAATACTAGTGG + Intronic
1080738733 11:35043569-35043591 CGCAGAATGACCAATTCTAGAGG + Intergenic
1081203627 11:40248737-40248759 GTGAGAATGAAAAATATTTGAGG + Intronic
1083566159 11:63718200-63718222 CTGAAAAGGAAAAAAACTAGTGG - Intronic
1086483661 11:87273061-87273083 CTGAGAATAATAAATATAAGAGG - Intronic
1087509932 11:99078963-99078985 CAAAAAATGACAAATACTTGAGG + Intronic
1087785925 11:102354126-102354148 CAGAGAAAGACAAATACAACTGG - Intronic
1088831581 11:113541090-113541112 CTGAGATTGACAAACACATGTGG + Intergenic
1089359646 11:117877239-117877261 CTGAAAATGACAACTACAACTGG - Intronic
1091437735 12:486047-486069 CTGAGAATTAAAAATTCCAGGGG + Intronic
1092590421 12:9948295-9948317 CAGAAAATAACAAATACTATAGG + Intergenic
1094043263 12:26140251-26140273 CTGAGAATGATGAAGACTGGAGG - Intronic
1095107378 12:38251078-38251100 GAGAGAATGACAAAAAATAGAGG + Intergenic
1097527527 12:60756294-60756316 CAGAGAATAGCTAATACTAGGGG - Intergenic
1098024270 12:66186245-66186267 TTGATAATGACAAATTCTAGGGG + Intergenic
1101826331 12:108223361-108223383 CTGAGAATGTAAAATTCTACAGG - Intronic
1102722532 12:115029838-115029860 CATAGAATGACAGATACCAGAGG - Intergenic
1103038674 12:117676980-117677002 CTGAGAATGACACTGACAAGTGG + Intronic
1103251439 12:119503311-119503333 CCCAGAATGACAAAGAGTAGAGG + Intronic
1103432186 12:120897898-120897920 CTGAGAATGGCAAATAACACAGG - Intronic
1104201814 12:126596902-126596924 CTGACAATTACAAATTCTTGAGG + Intergenic
1107656375 13:42596058-42596080 CTGAAAATGAAAAATATTAGGGG + Intronic
1108824573 13:54396960-54396982 CTGTAAAAGACAAATATTAGGGG + Intergenic
1109101881 13:58195534-58195556 CTGAGAATGGCAAATGTTGGTGG - Intergenic
1109581343 13:64340873-64340895 ATGAGAATGACAGGTAATAGAGG + Intergenic
1110358512 13:74597538-74597560 CTGATAATGATGAATAATAGAGG + Intergenic
1110973151 13:81793219-81793241 CTGAAAATACCAAATGCTAGTGG + Intergenic
1111121220 13:83852914-83852936 CTGACAATTTCCAATACTAGTGG + Intergenic
1112503800 13:99961317-99961339 CTGGGATTTAAAAATACTAGTGG + Intergenic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1115106255 14:29764895-29764917 CTCAGACTGACAAAGATTAGGGG + Intronic
1115235398 14:31204724-31204746 CTGCCAATGACAAAAACTAATGG + Intronic
1116756152 14:48950418-48950440 GTGAGAATGACAAATGGTACTGG - Intergenic
1117049745 14:51848194-51848216 CTTAGGATGACAAATAGTAAAGG - Intronic
1118686877 14:68300189-68300211 CTGAGAATGAAAATGACTAAAGG - Intronic
1122017446 14:98808281-98808303 AAGAGAATAACAAATACTTGGGG - Intergenic
1122862698 14:104589601-104589623 CTGTGGATGACAAACACCAGGGG + Intronic
1123134834 14:106018093-106018115 CTGAGAAGCACAGATCCTAGAGG + Intergenic
1123135996 14:106027649-106027671 CTGAGAAGCACAGATCCTAGAGG + Intergenic
1124128067 15:26956688-26956710 TTGAGAATGATAAATGCTTGAGG - Intergenic
1124991172 15:34675217-34675239 CTGAGGATGGCAGATACAAGGGG - Intergenic
1126287720 15:47033382-47033404 CTGAAACTAAAAAATACTAGAGG - Intergenic
1127124199 15:55796299-55796321 CTAAGAATGTAAAATCCTAGAGG + Intergenic
1129619954 15:77135255-77135277 CTGAGGATGACAATGAATAGGGG + Intronic
1137506867 16:49061665-49061687 ATTGGAATGACAAATACCAGGGG - Intergenic
1139165725 16:64563095-64563117 AAGAGAATGTCAAACACTAGTGG - Intergenic
1140424820 16:74852117-74852139 TTGAGAATGACACATATTGGAGG - Intergenic
1148317424 17:46715256-46715278 CTGGGAAGGACAGATACTATTGG - Intronic
1149192770 17:54083945-54083967 TTGAGAATCACAAATTTTAGTGG - Intergenic
1149582787 17:57762835-57762857 CTGAGAAAGACAAAAAGAAGTGG + Intergenic
1152175478 17:78784019-78784041 CAGAGGATGGCAAATACTGGGGG - Intergenic
1153858839 18:9177754-9177776 GAGAGAATGACAGATACCAGAGG - Intronic
1154135936 18:11778216-11778238 CTGAGGGTGAAAACTACTAGTGG - Intronic
1158048389 18:53185257-53185279 TTGATAATGACATATATTAGTGG + Intronic
1163992911 19:21015918-21015940 CTGATAAGGACAAAAACTAAAGG + Intergenic
1164432163 19:28197984-28198006 CTGAGAATGACAGAAGCTAGAGG - Intergenic
1166923679 19:46250511-46250533 CTGAGAATTAAAAATTCCAGGGG - Intergenic
925684915 2:6459865-6459887 GTGAGAATGGCACACACTAGGGG + Intergenic
925732863 2:6934291-6934313 CACAGAAAGAGAAATACTAGTGG - Intronic
927907041 2:26866269-26866291 CTGTGCATGACACATAATAGAGG + Intronic
929915059 2:46128154-46128176 ATGACAATAACAAAAACTAGAGG - Intronic
931027526 2:58129383-58129405 CTGAAAATGTAAAATATTAGTGG + Intronic
933261418 2:80135659-80135681 CTGTGAATGACACATCATAGGGG - Intronic
936100154 2:109570411-109570433 CTGAGGATCAAAAATATTAGGGG + Intronic
936744819 2:115562208-115562230 CAGAGAATGACAAATGTCAGTGG - Intronic
936890996 2:117370262-117370284 CTGATAATGACAATTGCAAGGGG - Intergenic
937146580 2:119651016-119651038 CTGAGAATCACTGAAACTAGAGG + Intronic
938712922 2:133990975-133990997 CTGGGAATCAGAAATTCTAGGGG - Intergenic
939716375 2:145589354-145589376 ATGAGAATGAGAAATTATAGGGG + Intergenic
941237376 2:162992156-162992178 CTTATAATGAGAAAAACTAGGGG - Intergenic
941891908 2:170591338-170591360 ATGATCATGAGAAATACTAGAGG - Intronic
946370810 2:219280194-219280216 CTGAGAATGCCCAAATCTAGGGG - Intronic
946484785 2:220090465-220090487 CTGAGAATGACAGAAGCTGGAGG - Intergenic
948761111 2:240191557-240191579 GTGAGAATGACAAATATCAGAGG - Intergenic
1168780942 20:489596-489618 ATGCAAATGACAAAGACTAGGGG + Intronic
1169527824 20:6449486-6449508 TTGACAATGTCAAATGCTAGTGG + Intergenic
1170248503 20:14251612-14251634 CTTAGATTAACAAATGCTAGTGG - Intronic
1170842109 20:19932439-19932461 CTGACAATGCCAAATACTCTAGG - Intronic
1173639848 20:44593504-44593526 CACAGAAAGACAAATACTACAGG + Intronic
1173789870 20:45821483-45821505 CTAAAAATAACAAAAACTAGTGG + Intergenic
1175213448 20:57376068-57376090 CTGAGACTGGGAAATACTAAAGG - Intronic
1175791167 20:61740740-61740762 CTCAGAATCACAAATGCTAGTGG + Intronic
1177581728 21:23031891-23031913 CAGACAATAACAAATGCTAGTGG - Intergenic
1179589802 21:42399309-42399331 CGGAGAAAGACAAATACTGCAGG + Intergenic
1180747778 22:18103145-18103167 AGTAGAATGACAATTACTAGAGG + Exonic
953876247 3:46668384-46668406 CTGAGAATGACAGATACCCAAGG - Intergenic
954064933 3:48098275-48098297 CTGCAAATGACAGATACTAATGG - Intergenic
956277460 3:67518156-67518178 CTGGTAATCACAAACACTAGAGG + Intronic
956969383 3:74504769-74504791 CCGAGAATGACAAAGAGTTGTGG - Intronic
959508769 3:107185161-107185183 CTGAGAAGTACAATAACTAGTGG + Intergenic
960337869 3:116440286-116440308 CTGAGAGTGCCAAATACAAAGGG - Intronic
960595340 3:119403189-119403211 CTGAAAATGACTAATATTAACGG - Intronic
961723898 3:128913294-128913316 CTGAGAAGGATAAAAACTAAGGG - Intronic
962450836 3:135515696-135515718 CTGAGAAAGACAAATAAAATGGG + Intergenic
962875324 3:139531660-139531682 TTCAGAATGAGAAATTCTAGGGG + Intronic
963944015 3:151125506-151125528 CTGTGAAAGATAACTACTAGTGG + Intronic
966754408 3:183355193-183355215 TTGAAAATGAAAAAAACTAGGGG + Intronic
967159546 3:186723439-186723461 AAGAGAATGACAGATACCAGAGG - Intronic
967735858 3:192951923-192951945 CTGGGAATGACAATTATGAGTGG - Intergenic
970082104 4:12299172-12299194 TTGAGAATGACTTATATTAGGGG + Intergenic
972485763 4:39538843-39538865 CAGAGAATTATTAATACTAGAGG + Intergenic
973615782 4:52676549-52676571 CTCAGAATGTCAAGTATTAGGGG + Intergenic
975726209 4:77294220-77294242 CTGAGCATGACCAAAAATAGAGG - Intronic
976633160 4:87260288-87260310 CTGATAATGAGAAATGGTAGAGG + Intergenic
976779332 4:88740715-88740737 TTGAGAAAGACAAATACAAAAGG - Intronic
976806171 4:89050028-89050050 CTGAGAAAGACAAATAGTACAGG + Intronic
976983165 4:91257628-91257650 TTAAGAATGAAAAATACTAAGGG + Intronic
978084860 4:104638651-104638673 ATAAGAATGTCAAATATTAGTGG - Intergenic
978474810 4:109114599-109114621 CTGGGAATTACAAATACTTCAGG + Intronic
982716419 4:158813334-158813356 CTGACAATGCCAAATGCTGGTGG - Intronic
983033335 4:162830805-162830827 CTGAGCATGACAAAGATTGGTGG - Intergenic
983076497 4:163332562-163332584 CTGAGCAGGAGAAATACCAGCGG - Exonic
983390965 4:167129084-167129106 CTGAGAATGACACAGAGTAGTGG + Intronic
984099791 4:175471690-175471712 CACAGAAAGACAAATACTACTGG - Intergenic
984579474 4:181494607-181494629 CTGAACATGACAGATAGTAGGGG - Intergenic
985202931 4:187503162-187503184 GTGAGAATGACAAACACCAAAGG - Intergenic
988039165 5:25865782-25865804 CTGATAATGTCAATTGCTAGTGG - Intergenic
988436834 5:31185768-31185790 GTGGAAATGACAAATACTGGAGG + Intergenic
990314651 5:54572519-54572541 CAAAGTATGCCAAATACTAGAGG + Intergenic
990567445 5:57043481-57043503 ATGAGCATGAGAAACACTAGTGG - Intergenic
991455885 5:66803916-66803938 CTGAGTATGATAAATGCTATGGG + Intronic
991514455 5:67418919-67418941 CTGAGGATGAGAAATACTGGAGG - Intergenic
993555462 5:89331277-89331299 TTGAGAATTACAAAGTCTAGAGG + Intergenic
994516737 5:100781960-100781982 CTCTGAATGACAACTTCTAGTGG - Intergenic
994785601 5:104157506-104157528 CTGAGATTTACAAATGCTACTGG + Intergenic
995967158 5:117921572-117921594 AGGAGAATGACAGATACTAGGGG + Intergenic
997312116 5:132895421-132895443 CTGAGAATCACATATACTACAGG - Intronic
997728596 5:136145018-136145040 GTTAGAATGACAGATACTGGGGG + Intronic
998318248 5:141203381-141203403 CAGACAGTGAAAAATACTAGGGG - Intergenic
1000112086 5:158117889-158117911 CTCTGAATCACAAATAATAGAGG - Intergenic
1000503351 5:162080502-162080524 TTGAGAATGAAAAAGTCTAGGGG + Intronic
1011890151 6:92148654-92148676 CTGAGAATGAGGATTTCTAGAGG - Intergenic
1012053083 6:94368485-94368507 CTAAGAATCACACATTCTAGAGG + Intergenic
1012376874 6:98572604-98572626 TTCAGAATGACTAAAACTAGTGG + Intergenic
1013039629 6:106420910-106420932 CTGATAATGCCAAATACCAGAGG + Intergenic
1014299176 6:119659171-119659193 CTGATGATGACAAACAATAGTGG + Intergenic
1015933792 6:138388292-138388314 CTGAGAATTAAAAACTCTAGGGG + Intergenic
1018556389 6:165055419-165055441 CTGAGAGTGAAAAACACCAGGGG + Intergenic
1021649097 7:22815669-22815691 CAGAGAATGACAGATACAAAAGG + Intronic
1022226799 7:28371613-28371635 CTGAGAAGGCCAGATACTAAAGG - Intronic
1025871955 7:65442949-65442971 CACAGAATGACAATTACTGGTGG - Intergenic
1028575518 7:92346009-92346031 CTGGGAATGACAGATTCTAAGGG - Intronic
1030439123 7:109563253-109563275 ATTAGAATGGCAAATTCTAGTGG + Intergenic
1031418282 7:121519122-121519144 CTTATAATTACAAATATTAGAGG - Intergenic
1032480937 7:132246560-132246582 CTGTGAATGAAAAATACCAAAGG - Intronic
1033073443 7:138225880-138225902 CTGAGAATGAGAAATCCTGGAGG - Intergenic
1035892434 8:3359566-3359588 GTAAGAATGAGAATTACTAGAGG + Intronic
1037119133 8:15262202-15262224 ATGAGAATGAGAAATTCTAGGGG + Intergenic
1037341291 8:17848298-17848320 CAGAGAATGCCAAGTACTGGAGG + Intergenic
1041454101 8:58039199-58039221 CTGAGAATGACAATGACTCTGGG - Intronic
1041741448 8:61161546-61161568 CATAGAAAGACAAATACTACAGG + Intronic
1042334453 8:67615456-67615478 CTGAAAATTACAAATATTGGAGG - Intronic
1043228923 8:77773148-77773170 CTAGAAATGATAAATACTAGAGG + Intergenic
1043453964 8:80395445-80395467 CTGAGAATGAAGAATCCTGGAGG + Intergenic
1044034757 8:87286963-87286985 CTGAAAAGGATAAATACTAGAGG + Intronic
1045502972 8:102757456-102757478 CAGAAAGTGACAAATACTAAAGG + Intergenic
1047730806 8:127726541-127726563 CTAAAAATGACAAAAATTAGCGG - Intergenic
1052230950 9:26152158-26152180 CTGAGAAATAGAAATACTTGGGG - Intergenic
1052707354 9:32010063-32010085 ATGTAAATGACAAATATTAGAGG + Intergenic
1054915021 9:70487601-70487623 CAAAGAATGATAAATACTTGAGG + Intergenic
1055010904 9:71564020-71564042 CTAAGAATGAAATAAACTAGAGG + Intergenic
1055824161 9:80303815-80303837 GTGAGGATGAGAAATATTAGTGG + Intergenic
1059677386 9:116552474-116552496 CTGAGAGAGGCAAATTCTAGTGG - Intronic
1061757476 9:132825095-132825117 CTGAAAAGCACAAATACTACAGG + Intronic
1186377989 X:9028464-9028486 TTGGGAATGACAAAATCTAGGGG - Intronic
1186619659 X:11225157-11225179 TTGGGAATGACAAAATCTAGGGG + Intronic
1186795030 X:13038985-13039007 CTGGGAATGACAAAATTTAGGGG - Intronic
1187546672 X:20261108-20261130 CTCAGAATGAGAGTTACTAGAGG + Intronic
1189090289 X:38075074-38075096 CTGCAAATGACAACTCCTAGAGG - Intronic
1192123462 X:68478202-68478224 TTGAGGATGAGAAATACTGGAGG - Intergenic
1192631147 X:72778552-72778574 CTGAGAAAGACAAATAGAACTGG - Intronic
1192650562 X:72942249-72942271 CTGAGAAAGACAAATAGAACTGG + Intronic
1195209435 X:102638537-102638559 ATAGAAATGACAAATACTAGAGG - Intergenic
1198598023 X:138258292-138258314 TTGAGAATGAGAAATATGAGGGG - Intergenic
1200020798 X:153204911-153204933 TTGGGAATGACAAAATCTAGGGG + Intergenic
1200674855 Y:6137510-6137532 CTCAGACAGACAAATACTAAGGG + Intergenic