ID: 903767982

View in Genome Browser
Species Human (GRCh38)
Location 1:25747026-25747048
Sequence CCTTGCAGGGAGGGGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 487}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903767982_903767992 -2 Left 903767982 1:25747026-25747048 CCATCCATCCCCTCCCTGCAAGG 0: 1
1: 0
2: 6
3: 51
4: 487
Right 903767992 1:25747047-25747069 GGTCAGTCATTGCTCATCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 109
903767982_903767994 21 Left 903767982 1:25747026-25747048 CCATCCATCCCCTCCCTGCAAGG 0: 1
1: 0
2: 6
3: 51
4: 487
Right 903767994 1:25747070-25747092 CACATTGCTTCCACCCTGGACGG 0: 1
1: 0
2: 2
3: 17
4: 142
903767982_903767995 28 Left 903767982 1:25747026-25747048 CCATCCATCCCCTCCCTGCAAGG 0: 1
1: 0
2: 6
3: 51
4: 487
Right 903767995 1:25747077-25747099 CTTCCACCCTGGACGGCCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 195
903767982_903767990 -4 Left 903767982 1:25747026-25747048 CCATCCATCCCCTCCCTGCAAGG 0: 1
1: 0
2: 6
3: 51
4: 487
Right 903767990 1:25747045-25747067 AAGGTCAGTCATTGCTCATCTGG 0: 1
1: 0
2: 0
3: 10
4: 100
903767982_903767997 30 Left 903767982 1:25747026-25747048 CCATCCATCCCCTCCCTGCAAGG 0: 1
1: 0
2: 6
3: 51
4: 487
Right 903767997 1:25747079-25747101 TCCACCCTGGACGGCCCCTGGGG 0: 1
1: 1
2: 0
3: 24
4: 176
903767982_903767996 29 Left 903767982 1:25747026-25747048 CCATCCATCCCCTCCCTGCAAGG 0: 1
1: 0
2: 6
3: 51
4: 487
Right 903767996 1:25747078-25747100 TTCCACCCTGGACGGCCCCTGGG 0: 1
1: 0
2: 1
3: 6
4: 143
903767982_903767993 17 Left 903767982 1:25747026-25747048 CCATCCATCCCCTCCCTGCAAGG 0: 1
1: 0
2: 6
3: 51
4: 487
Right 903767993 1:25747066-25747088 GGGGCACATTGCTTCCACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 250
903767982_903767991 -3 Left 903767982 1:25747026-25747048 CCATCCATCCCCTCCCTGCAAGG 0: 1
1: 0
2: 6
3: 51
4: 487
Right 903767991 1:25747046-25747068 AGGTCAGTCATTGCTCATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903767982 Original CRISPR CCTTGCAGGGAGGGGATGGA TGG (reversed) Intronic
900098795 1:952257-952279 CCTTGCAGGTGGGGGAAGGGTGG - Intronic
900142495 1:1144577-1144599 CCTGGCAGGGAGGGGAGCGCTGG - Intergenic
900435516 1:2628963-2628985 CCAGGCAGGGAGGGGGTGGGCGG + Intronic
900643532 1:3698491-3698513 CCTGGAAGGGAGGGGCTGGTGGG + Intronic
901197906 1:7450459-7450481 GCTGGAGGGGAGGGGATGGAAGG + Intronic
901636098 1:10670858-10670880 CCCTTCTCGGAGGGGATGGAGGG - Intronic
901660935 1:10797234-10797256 CCTTACATGGAGGGGCTGGGGGG + Intergenic
902132966 1:14279898-14279920 GCCTGCAGCGAGGGGATGTAGGG - Intergenic
902819649 1:18936198-18936220 GCTGGCAGGGAGGGGCTGGCAGG - Intronic
903035558 1:20490462-20490484 CCTTTCAAGGAGGGTAGGGAAGG - Intergenic
903170253 1:21548093-21548115 CCTGGCAGAGAAGGGAGGGAGGG + Intronic
903623976 1:24718133-24718155 CCTAGAAGGGATGGGATGGATGG + Intergenic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
903875939 1:26472930-26472952 GCCCGCAGGGAGGGGAGGGAAGG - Intronic
904470591 1:30733714-30733736 CCTGCCAGGGAGGGGCGGGAGGG + Exonic
904489156 1:30847628-30847650 AGCTGCAGGGAGGGGAGGGAGGG - Intergenic
904997942 1:34645690-34645712 CTTTGCAGGGTGGGAGTGGAGGG - Intergenic
905396316 1:37668965-37668987 CCATGCTGGGAGGAGATGGATGG - Intergenic
905795333 1:40812949-40812971 TCTTTCAGAGAGGGGATGGCTGG + Intronic
905824886 1:41020136-41020158 GCCTGCAGAGTGGGGATGGAGGG - Intronic
906145485 1:43557983-43558005 CCTAGGAGGGAGGGGAGGGGTGG - Intronic
907305234 1:53509470-53509492 CCCTGCAGGGAGGGGAGGGCAGG + Intronic
907951025 1:59184321-59184343 CCTTGCAGTGTGGGGATGTGAGG + Intergenic
908138455 1:61157312-61157334 TTTTGCAGGGAGTGGAGGGAAGG - Intronic
908863260 1:68514534-68514556 CTTTGCAGAGAGGGAATGAAAGG + Intergenic
913128681 1:115816958-115816980 CTTTGCTGGGAGGTCATGGAAGG + Intergenic
913491554 1:119384622-119384644 CCTTGTAAGAAAGGGATGGAAGG - Intronic
913971821 1:143422405-143422427 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914066200 1:144248018-144248040 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
914112953 1:144718336-144718358 ACTTCCAGGCAGGGGAAGGACGG + Intergenic
914302813 1:146390888-146390910 CCAGGCAGGGAGGGTAGGGAAGG + Intergenic
914338607 1:146739231-146739253 TCTTGGTGGGAGGGGAGGGAAGG + Intergenic
914440370 1:147700311-147700333 CCAGTCAGGGAGGGGAGGGATGG - Intergenic
914517004 1:148382795-148382817 CCAGGCAGGGAGGGTAGGGAAGG - Intergenic
914675557 1:149904940-149904962 CAGGGCAGGGAGGGGAAGGAAGG + Exonic
914825401 1:151135540-151135562 CAAAGCAGGGAGGGGATGGGAGG - Intronic
914884665 1:151575039-151575061 GGTTGCAGGGAGGGGAGGGCAGG + Intronic
915243590 1:154541251-154541273 CCATGCAGGGGAGGGATGGCGGG + Intronic
915369424 1:155335895-155335917 CATTGCAGGGAGTGGGTGGGAGG - Intronic
916891144 1:169113674-169113696 TCTTTTAGGAAGGGGATGGAAGG - Intronic
917073614 1:171179881-171179903 CCATGCTGGGAGGTGATGGGTGG + Intergenic
920017690 1:202926993-202927015 CCTTGCAGGGAGACCAAGGATGG + Intronic
920115527 1:203618145-203618167 CCTGGCTGGGAGGGGATGCTGGG - Intergenic
921446198 1:215249851-215249873 CATTTCAGTGATGGGATGGAAGG + Intergenic
921710160 1:218365619-218365641 CCTTGCAGGGAAGGTCTGAAAGG - Intronic
922182716 1:223247858-223247880 CTTAGCACGTAGGGGATGGAGGG - Intronic
922331209 1:224578009-224578031 GCTTGCAGGGAAGGGTGGGAGGG + Intronic
922466087 1:225846198-225846220 CCTTGGAGGGAGCAGACGGAGGG + Exonic
922718365 1:227888217-227888239 CCAGGCTAGGAGGGGATGGATGG + Intergenic
923035863 1:230284837-230284859 CCACGGTGGGAGGGGATGGAGGG - Intergenic
923791615 1:237116147-237116169 CCCTGCAGGGAGGGGAGAGCAGG + Intronic
924131037 1:240908583-240908605 CCTGGCAGGGAGGGAGTGGAAGG - Intronic
924707353 1:246511090-246511112 GCTTGCAGGGAGGGGTGGGGGGG + Intergenic
1062923564 10:1297807-1297829 CCATGGAGGCAGGGGCTGGAGGG + Intronic
1063364328 10:5480662-5480684 CCCTCCAGGGAGGGGAAGGCAGG - Intergenic
1064031352 10:11885309-11885331 CCGAGCTGGGAGGGGATGGGTGG + Intergenic
1064099505 10:12451323-12451345 GCTGGCCAGGAGGGGATGGAGGG - Intronic
1064179021 10:13099438-13099460 CGCTGCAGGGATGGGAGGGAGGG - Intronic
1064700103 10:18009600-18009622 CTTTGCAGGCAGGGGATTGGGGG + Intronic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1065916598 10:30358542-30358564 CCTGGAAGAGAGGGGCTGGAAGG - Intronic
1066201079 10:33143171-33143193 CCTTGCTGTTAGGGGATGCATGG + Intergenic
1069819411 10:71218118-71218140 GTTTGCAGGGAGGGGAGGGTGGG + Intronic
1070179053 10:73997627-73997649 CATTGCTGGGAGGGAATGGAAGG + Intergenic
1071218193 10:83432187-83432209 AATTTCAGAGAGGGGATGGAAGG - Intergenic
1071219193 10:83444007-83444029 AATTTCAGTGAGGGGATGGAAGG - Intergenic
1071858053 10:89645322-89645344 GCTTGCAGAGAGGAGATGGGCGG + Exonic
1072518251 10:96208025-96208047 CCTTGCAGGGTGGAGAGGGATGG + Intronic
1073491496 10:103855755-103855777 CCTGGCAGGCAGGGAAGGGAAGG + Intergenic
1073522790 10:104150286-104150308 CCTGGCAGGGAGTGGATGTATGG - Intronic
1074039124 10:109770677-109770699 CCTTGCAGGGAAGGCTTTGAGGG - Intergenic
1074053452 10:109900546-109900568 CCTTGCAGGCAGGTGGTAGAGGG - Intronic
1074462186 10:113647885-113647907 CCTTTCTGGGAGTGGATGGATGG - Intronic
1075579169 10:123603803-123603825 TCTTGCTGGGAGGAGATGAAAGG - Intergenic
1075617248 10:123899643-123899665 CCTGGGAGGAAGGGGAAGGAAGG + Intronic
1075814800 10:125256686-125256708 CCAGCCAGGGTGGGGATGGAGGG + Intergenic
1076100782 10:127776182-127776204 GATTTCAGGGAGGGGATGGAAGG - Intergenic
1077252126 11:1565355-1565377 CCCTGGAGGGAGGGTAGGGAAGG + Intronic
1077431297 11:2517212-2517234 CCCTGCAGGGTGGGGACTGATGG - Intronic
1078084791 11:8227302-8227324 CCTTCCAGGGAGGGTGTGTAGGG + Intronic
1078749930 11:14151942-14151964 TCTGGCAAGGAGGGTATGGAAGG - Intronic
1078829904 11:14969169-14969191 CAATGCAGGGAAGGGCTGGATGG + Intronic
1078896736 11:15603512-15603534 TCTTGCAGGGGAGGGAGGGAGGG + Intergenic
1080248171 11:30203138-30203160 CCTGGGAGGGAGGTGATGGTAGG + Intergenic
1081752150 11:45518828-45518850 CCTAGCAGGGAGGGGCAGGAAGG - Intergenic
1081758070 11:45558841-45558863 ACTTATAGGCAGGGGATGGAGGG - Intergenic
1083096249 11:60254377-60254399 CTTGGCAGAGAGGGGATGCAAGG - Intergenic
1083625426 11:64069660-64069682 CCCTGCAGGGAAGCCATGGAGGG - Intronic
1083718754 11:64593627-64593649 CCTTGCAGTGATGGAGTGGACGG + Exonic
1083759581 11:64808237-64808259 CGTGGGAGGGAAGGGATGGAGGG - Intronic
1084173204 11:67410368-67410390 CCCTGGAGGGAGGGGAAGGAGGG - Intronic
1084310805 11:68315063-68315085 CCTTGCAGCGACGGGTTGCAGGG + Intronic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1084773503 11:71359567-71359589 TGTTGCAGGGAGGGTATGCATGG + Intergenic
1084877504 11:72144066-72144088 ACTTGCAGGGTCCGGATGGAGGG - Intergenic
1085025486 11:73234135-73234157 CCCTGCAGGGAAGGGAGGGGTGG - Exonic
1085305445 11:75483068-75483090 CCTGGCAGGAAGGGGAGGGGAGG - Intronic
1085387059 11:76163532-76163554 TCATGCAGGGAGAGGGTGGAAGG - Intergenic
1086343818 11:85875051-85875073 TTTAGCAGGGAGGGGATGCAGGG + Intronic
1086862731 11:91944162-91944184 CCTTGCAGAGAGAGGATGTAGGG - Intergenic
1088008350 11:104969357-104969379 TCTTGCCGGGAGAGGAGGGATGG - Exonic
1088751754 11:112847944-112847966 CCTAGCAAGGTGGGGGTGGAGGG - Intergenic
1090270377 11:125381646-125381668 GCTTGCAGGGATGGGGTGGGAGG - Intronic
1090352833 11:126118503-126118525 ACTTGCAGGGAAGGGTGGGAAGG + Intergenic
1090824918 11:130378287-130378309 GATTTCAGGGAGGGGACGGAAGG - Intergenic
1090888020 11:130896550-130896572 GCTTGCATGGAGGGGAAGCATGG + Intronic
1091311505 11:134578201-134578223 CTTGGCAGGCAGGGGATGGGGGG + Intergenic
1092234175 12:6795805-6795827 CCTTTCAGAGATGAGATGGAAGG - Intronic
1092572467 12:9739958-9739980 GCTTGCAGGGAGGTGTGGGAGGG - Intergenic
1093816069 12:23548996-23549018 TCTTTCAGAGAGGGGATGGCTGG - Intronic
1094480173 12:30875170-30875192 CCAGGCAGGGAGGGGAGGGCTGG + Intergenic
1095890152 12:47228407-47228429 TCATGAAGGGAGGGGATGGGTGG - Intronic
1096584686 12:52612183-52612205 CTTTCCAGGGCTGGGATGGAGGG + Intronic
1096712131 12:53465201-53465223 ACAGGGAGGGAGGGGATGGAAGG - Intronic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1097520355 12:60661311-60661333 CCTTTCAGAGAGGGGAGGGAAGG - Intergenic
1100208550 12:92377416-92377438 CCTAGCAGGGTTGGGATGAAAGG + Intergenic
1100843511 12:98636893-98636915 CCTGGCAGGGAGGGACAGGAAGG - Intronic
1102222750 12:111205412-111205434 CCTTGTGGCGGGGGGATGGAGGG - Intronic
1102729354 12:115094391-115094413 CCTTCAAGGGAGGCCATGGAAGG + Intergenic
1103449501 12:121018456-121018478 CCAAGGAGGGAGGGGAGGGAGGG + Intergenic
1104051569 12:125198006-125198028 CCTTGTAGGGAGGCTGTGGAGGG + Intronic
1104326928 12:127808012-127808034 CCTTGCGAGGAGCAGATGGAAGG - Intergenic
1104674920 12:130705840-130705862 CCTTGCAGGGATGGGTAGGCTGG - Intronic
1106301941 13:28474656-28474678 GCTTGCGGGGAGGGGATGGAGGG + Intronic
1106303539 13:28490790-28490812 CATTGCAGGTAGGGGAGGAAGGG - Intronic
1107112663 13:36714787-36714809 CCTTGAGAGGAGGAGATGGAAGG + Intergenic
1107835245 13:44407613-44407635 CCTTGCAGGGAGGTGATGACAGG + Intergenic
1108956150 13:56160125-56160147 CCTTGCAGAATGGGGTTGGAAGG - Intergenic
1109196671 13:59385213-59385235 CTTTGCAGGGGAGGAATGGAGGG + Intergenic
1110409140 13:75184925-75184947 CCATTCAGTCAGGGGATGGAAGG - Intergenic
1110746985 13:79065464-79065486 CCTTGGAGGCAGGAGATGGCAGG - Intergenic
1111650694 13:91087534-91087556 CCTGGCAGGAAAGGGAAGGAAGG + Intergenic
1112267479 13:97938252-97938274 GATGGCAGGGAGGGGCTGGAGGG + Intergenic
1113633490 13:111904240-111904262 CTTTAGAGGGAGGGCATGGAGGG + Intergenic
1113641684 13:111962257-111962279 CCTTGCAGGGATGAGAATGACGG - Intergenic
1113707212 13:112442684-112442706 CCGTGCAGGGAGGGACTGCAGGG - Intergenic
1113935492 13:113992439-113992461 CTGTGCAGCGAGGGGATGGCTGG - Intronic
1113955820 13:114099529-114099551 CCAGGCAGGGAGGGAAAGGAGGG - Intronic
1115475878 14:33812303-33812325 CCCACCAGGGAGGGGATGGGCGG - Intergenic
1116269324 14:42741422-42741444 CCTTGCAGGCAGGGGGTGGGGGG - Intergenic
1117722798 14:58643812-58643834 CGTTGCTGGGAGAGGAAGGATGG + Intronic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1119054708 14:71407510-71407532 CCTGGGAGGGAGGGAAAGGAGGG - Intronic
1119148004 14:72333782-72333804 TCTGGCAGGGAGGGGATGGAGGG - Intronic
1119170760 14:72534766-72534788 CTTTCCAGGGAAGGGATCGAAGG - Intronic
1119380677 14:74226250-74226272 CCTGGTAGGGTGGGGGTGGAGGG - Intergenic
1119998142 14:79275715-79275737 TCTTGCAGGGTGAGGATGGGGGG + Intronic
1120325889 14:83025738-83025760 GCAGGCAGGGAGGGGAGGGAAGG + Intergenic
1122254079 14:100463986-100464008 CCATGCAGGGAGGAGAATGAAGG - Intronic
1122783241 14:104152563-104152585 CCCTGAAGGGAGGGGACGGCGGG + Intronic
1123704993 15:22944816-22944838 CCTGGCAGGGTGTGGCTGGAGGG + Intronic
1125194398 15:37030199-37030221 ACTTTCAGGGATGGGGTGGAAGG - Intronic
1125521891 15:40352713-40352735 CAGTGCAGGGACGGGAAGGATGG - Intronic
1125892345 15:43276050-43276072 GCCTGCAGGCAGAGGATGGAGGG - Intergenic
1127334605 15:57971296-57971318 CCCTGTAGGGAGGGTAGGGAAGG - Intronic
1128301691 15:66570124-66570146 CCTTGCAGGGAGGGAAGAAAAGG - Intergenic
1128670337 15:69570039-69570061 AATTTCAGGAAGGGGATGGAAGG - Intergenic
1129302909 15:74636574-74636596 CAATGTAGGGAGGAGATGGACGG + Intronic
1130910873 15:88270033-88270055 CCTTTCAGGCTGGGGATGGGAGG - Intergenic
1130953533 15:88610971-88610993 GCCTGCAGGGAGGGGATGACTGG + Intergenic
1132205938 15:99986144-99986166 CCTTGCAGGGTGGGGCAGGGGGG + Intronic
1132688752 16:1172979-1173001 CCTGGGAGGGAGGGGAGGGGTGG + Intronic
1132706478 16:1245737-1245759 GCTGGCAGGGAGGGGCTGCACGG - Intergenic
1132884539 16:2176823-2176845 CCATCTAGGGTGGGGATGGAGGG - Exonic
1133439313 16:5807233-5807255 CCGTGAAGGGAGAGGAGGGATGG - Intergenic
1133863490 16:9619319-9619341 GCTTGGAGGGAGGTGATGGGAGG - Intergenic
1134031008 16:10992281-10992303 CTGGGCAGGGAGGGGATGCAGGG - Intronic
1134038861 16:11052618-11052640 CCTGGCAGGGAGGACATGGAAGG - Intronic
1135288845 16:21217328-21217350 GATTTCAGGGAGGGGATAGAAGG - Intergenic
1135468950 16:22712212-22712234 CCTTGAAGGGTGGAGCTGGAAGG + Intergenic
1135533906 16:23277997-23278019 CCAGGCAGGGTGGGGAGGGAGGG + Intergenic
1135817847 16:25652244-25652266 CCATGGATGGAAGGGATGGAGGG + Intergenic
1136609201 16:31356029-31356051 CTGAGCAGGGAGAGGATGGATGG - Intronic
1136712683 16:32253225-32253247 CCGTGCAGGGAGGGGGAGGGCGG - Exonic
1136755233 16:32676204-32676226 CCGTGCAGGGAGGGGGAGGGCGG + Exonic
1136812880 16:33194165-33194187 CCGTGCAGGGAGGGGGAGGGCGG - Exonic
1136819356 16:33304245-33304267 CCGTGCAGGGAGGGGGAGGGCGG - Intronic
1136825919 16:33360780-33360802 CCGTGCAGGGAGGGGGAGGGCGG - Exonic
1136830985 16:33459551-33459573 CCGTGCAGGGAGGGGGAGGGCGG - Intergenic
1137029339 16:35507093-35507115 CCGTGCAGGGAGGGGCAGGGCGG + Intergenic
1137943055 16:52707842-52707864 ACTTGGGGGGAGGGGAAGGAAGG - Intergenic
1138148941 16:54637451-54637473 CATTGCAAGGAGGGGATGGTAGG - Intergenic
1138489415 16:57367457-57367479 CCTTGGATGGATGGGATTGATGG - Intergenic
1138528182 16:57620730-57620752 TCTTGCAGCCAGGGGAGGGAGGG - Intronic
1138580724 16:57939130-57939152 GCTGGCAGGGAGAGGCTGGAAGG + Intronic
1138715870 16:59021509-59021531 CCCAGCAGGGAGGGGCTGGAGGG + Intergenic
1139367830 16:66444470-66444492 CAGTGCAGGGGGAGGATGGAGGG + Intronic
1139466099 16:67155012-67155034 CGTTGCCGGGTGGGGATGGGTGG - Intronic
1140315546 16:73893113-73893135 CCTTGCAGGGAAAGGAAGAAAGG + Intergenic
1141614692 16:85203457-85203479 CCCCTCAGGGAGGGGTTGGATGG + Intergenic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1141798468 16:86290889-86290911 GGCTGGAGGGAGGGGATGGATGG - Intergenic
1142190757 16:88716276-88716298 CCCTGCAGGGAGGTGCTGGCAGG + Exonic
1142359572 16:89619778-89619800 CGCTGCAGGGAGGGGGTGCAGGG - Intronic
1142418985 16:89958756-89958778 CCTTGCAGCGAGGGGCTGTGTGG - Intronic
1202991457 16_KI270728v1_random:17135-17157 CCGTGCAGGGAGGGGGAGGGCGG - Intergenic
1203057375 16_KI270728v1_random:936543-936565 CCGTGCAGGGAGGGGGAGGGCGG + Intergenic
1142874549 17:2843650-2843672 CCTTGCAGGGTGGGGCGGGGTGG + Intronic
1143040757 17:4034602-4034624 GGTTGCAGGGAGGGGATTTAGGG - Intronic
1143102899 17:4513993-4514015 CCCTGGAGGGAGGGGCTGGTGGG - Intronic
1143364425 17:6396591-6396613 CCTTGCAGGGAGGGCAAGCGAGG - Intronic
1143649752 17:8256234-8256256 CGATGCAGGGAGGGGAAGGCAGG - Intronic
1143915973 17:10293265-10293287 CAGTGCAGGGAAGGGAGGGAAGG - Intergenic
1144493885 17:15735340-15735362 TCTTGCAGGATGGAGATGGATGG + Exonic
1144578909 17:16447007-16447029 CCCTGCAGGCTGGGGAAGGAAGG - Intronic
1144740582 17:17580076-17580098 CCCTGAAGGGAGGGGAAGGGAGG + Intronic
1144844409 17:18208895-18208917 GCTTGCAGGGCGTGGATGGCAGG - Exonic
1145238647 17:21226580-21226602 CCTAGCAGGGAGGCGAGGGCTGG - Intergenic
1146183747 17:30712057-30712079 GCCTGCAGGGAGGGGGTGGAAGG + Intergenic
1146226969 17:31075386-31075408 TCCTGCAGGGAGGGGGTGGGTGG - Intergenic
1146902962 17:36600221-36600243 CCATGAAGGGTGGGGAGGGAAGG - Exonic
1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG + Intronic
1147928627 17:43961944-43961966 ACTTCCAGGCAGGGGATTGAGGG - Intronic
1148181983 17:45612743-45612765 CATGGCAGGGAGGGGATGGCGGG + Intergenic
1148238550 17:45984760-45984782 CCCTGCAGGGAGGGATTGGTGGG + Intronic
1148266876 17:46232957-46232979 CATGGCAGGGAGGGGATGGCGGG - Intergenic
1148271782 17:46267101-46267123 GCTTGCCGGGCGGGCATGGACGG + Intergenic
1148348723 17:46923077-46923099 CCTGGCCGGCAGGGGAGGGAGGG + Intergenic
1148443783 17:47725731-47725753 CCCTGCGGGGAGGGGCTGGCTGG - Intergenic
1148637031 17:49156719-49156741 CCAAGGAGGGAGGGGATGGAAGG + Intronic
1148674880 17:49439356-49439378 CCTTGTAGGGACTGAATGGAGGG - Intronic
1149300807 17:55303389-55303411 ACTTGCAGGGAATGGATGGTAGG - Intronic
1149713117 17:58760972-58760994 TCATGCTGGGAGGGTATGGAAGG - Intronic
1150359168 17:64515479-64515501 GCTCGCAGGAAGGGGAGGGATGG + Intronic
1151130688 17:71893581-71893603 CCTTTGAGGTAGGGAATGGAGGG - Intergenic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151817774 17:76479628-76479650 CCTTCCAGAGAGGGGACGCAGGG + Intronic
1151835761 17:76581683-76581705 CCTGAGAGGGAGGGGCTGGAAGG - Intronic
1151837167 17:76589533-76589555 CCTTGCAGAGGGGGCAGGGAGGG - Intergenic
1152113345 17:78369650-78369672 CCTGGCAGGGAAGGGAAGGAAGG - Intergenic
1152141989 17:78541901-78541923 CGTGGCAGGGAGGGGAGGGATGG + Intronic
1152554045 17:81044241-81044263 CTTCACAGGGAGGGGATGGATGG + Intronic
1153757703 18:8300714-8300736 ACTGGAAGGGATGGGATGGAGGG - Intronic
1153774044 18:8437338-8437360 CCCTGCTGGGAGAGGGTGGAGGG - Intergenic
1154351828 18:13589828-13589850 GAATGCAGGGAGGGAATGGAGGG + Intronic
1155319239 18:24602601-24602623 CCTTGCTGTGATGGGATGTATGG + Intergenic
1156153962 18:34279883-34279905 CATAGTAGGGAGGGGATTGAAGG - Intergenic
1156178568 18:34576351-34576373 ACTTGCAGGGAGGGAATCAAGGG + Intronic
1157401787 18:47394890-47394912 CTTTGCAGGGTAGAGATGGAGGG + Intergenic
1157499556 18:48180055-48180077 CCTTGCAAGGAAGGTACGGAGGG - Intronic
1157544594 18:48539134-48539156 CCCAGCAGAGAGGGGAGGGAGGG - Intronic
1157557287 18:48621274-48621296 GCTGGCATGGAGGGGAGGGAGGG + Intronic
1159241580 18:65750115-65750137 CCTTGCAAGGTGTGGAAGGAAGG - Intergenic
1159545991 18:69839714-69839736 CCTGGGAGAGAGGGGAAGGAGGG + Intronic
1160086241 18:75780005-75780027 ACCTGCAGGGAGGGGAGAGAGGG - Intergenic
1160448933 18:78948847-78948869 CCTGGCAGGGCGTGCATGGAGGG - Intergenic
1160991231 19:1861135-1861157 GCCAGCAGGGAGGGGAGGGATGG - Intronic
1162782846 19:13015599-13015621 CCTGGCAGGCAGGGAATGGGGGG - Intronic
1162975049 19:14203696-14203718 GCCTGCAGGGAGGGGGTGGAAGG - Intronic
1163749261 19:19065564-19065586 CTTTGCAGGGAGCGGTGGGAGGG - Intronic
1164260534 19:23565211-23565233 CCTTGCAGGAAGGGTCAGGAAGG + Intronic
1165404764 19:35622816-35622838 TTTTGCAGGGAGGGTCTGGAGGG + Intronic
1165760119 19:38316047-38316069 CCGTGAAGGGGGGGGCTGGAGGG - Intronic
1165787289 19:38469284-38469306 GCCTGGTGGGAGGGGATGGATGG - Exonic
1165993093 19:39826987-39827009 CCTGGCAGGGAGGGGGTGGGAGG + Exonic
1166690969 19:44821045-44821067 CCTTGCCGGCAGAGGAAGGAAGG - Exonic
1166992188 19:46699220-46699242 AGTTGAAGGGAGGGGAGGGAAGG - Intronic
1167409628 19:49337252-49337274 CCCAGCAGGGAGGAGAGGGAAGG + Intronic
1167739673 19:51316939-51316961 CCTGGGAGGTAGGGGGTGGAGGG - Intronic
1168290246 19:55354089-55354111 CCTGGCTGGGAGGGGCGGGACGG - Exonic
1168724263 19:58572211-58572233 CCAAGCAGGGAGGGGAATGATGG - Intronic
925091195 2:1157167-1157189 GCTGGCAGTGATGGGATGGAGGG - Intronic
925288166 2:2729438-2729460 CCTAGCTGGGAGGGGACAGATGG - Intergenic
925306044 2:2848915-2848937 CCAGGGAGGGAGGGGAGGGAGGG + Intergenic
925330030 2:3051515-3051537 CCAGGCAGGGAAAGGATGGAAGG + Intergenic
925337971 2:3112438-3112460 CCATGCAGAGTGGGGCTGGAGGG - Intergenic
925343558 2:3153546-3153568 ACTTGCAGGGAAGGGTGGGAGGG + Intergenic
925830293 2:7887307-7887329 GCCTGCAGGGAGGTGATGGTAGG - Intergenic
926229505 2:10992050-10992072 TCCTGCAGGGAGGGAATGGATGG + Intergenic
926555724 2:14355602-14355624 GGTTTCTGGGAGGGGATGGAAGG - Intergenic
926959282 2:18336723-18336745 CTTGGCAGGGAGGGGAGGAAGGG - Intronic
927155966 2:20221913-20221935 CCTGGCAGAGAGGGTATGGGGGG - Intronic
927479967 2:23445423-23445445 CCTTGAAGGGCTGGTATGGAGGG - Intronic
927638512 2:24832525-24832547 CCTTCCAGGGAGGGGTTAAACGG - Intronic
927720226 2:25377638-25377660 CCCTGCAGGGAGGGGCTGCTAGG + Intronic
927853409 2:26513699-26513721 CCTTCCCAGGAGAGGATGGAGGG + Intronic
928538543 2:32262836-32262858 GCTTGCGGGGAGGGGTTGCAGGG - Intronic
928738050 2:34315542-34315564 CATTTCAGGGAGGGGATCAAAGG - Intergenic
929209131 2:39334707-39334729 CCTCTCAGGGAGGGAAAGGAGGG - Intronic
929508301 2:42546089-42546111 CCTGGTAGGGAAGGGAAGGAGGG + Intronic
929756228 2:44767996-44768018 TCTTTCAGGGAGGAGACGGAGGG - Intronic
930019970 2:46995548-46995570 CATGGCAGGTAGGGAATGGAAGG + Intronic
930448985 2:51510670-51510692 ACTTGCTGTGAGGGGAAGGAGGG + Intergenic
931041566 2:58306036-58306058 CATGGGAGGGAGGGGTTGGAAGG + Intergenic
931165412 2:59741848-59741870 ACATGCATGGTGGGGATGGAGGG - Intergenic
932140360 2:69271931-69271953 CAGTGCAGAGATGGGATGGAGGG - Intergenic
932305945 2:70704437-70704459 TCTTTCAGGGAGGAGCTGGAAGG - Exonic
932594553 2:73086065-73086087 CCTTGCAGGGAGGGGAAGGCTGG - Intronic
933646078 2:84813731-84813753 CCTGGCTGGGAAGGGAGGGAAGG - Intronic
933989664 2:87625203-87625225 CAATGCAGGGATGGCATGGATGG + Intergenic
934176511 2:89583337-89583359 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934286821 2:91657698-91657720 ACTTCCAGGCAGGGGAAGGACGG - Intergenic
934656517 2:96119248-96119270 CCTGGCGGGGCAGGGATGGAGGG - Intergenic
934972498 2:98774608-98774630 TCTTGCAGGAAGTGGATGAAGGG - Intergenic
935349540 2:102141888-102141910 CCTTGCAGGGAGAGGAGGGGAGG - Intronic
935663293 2:105488105-105488127 TCTTGGAGGGTGGGGAGGGACGG + Intergenic
935815755 2:106844272-106844294 CTTTGGAGAGAGGCGATGGATGG + Intronic
936304180 2:111325623-111325645 CAATGCAGGGATGGCATGGATGG - Intergenic
937297449 2:120818137-120818159 CCTTGCAGAGAGGTGGTGGGAGG + Intronic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
937368195 2:121280367-121280389 CCTGGCAGTGATGGGATGGCTGG - Intronic
939233907 2:139466899-139466921 CATTTTAGGGAGGGGGTGGAAGG + Intergenic
940201434 2:151155645-151155667 ACTTGCAGGGAAGTGTTGGAAGG + Intergenic
940581246 2:155583965-155583987 CCCTGTGGGGAGGGGAGGGAGGG - Intergenic
941037027 2:160579967-160579989 CCTTGCAGGGAGGTGTTTAAAGG + Intergenic
941708037 2:168680551-168680573 CCTTGGAGGGTGGGGTGGGAGGG - Intronic
942452710 2:176118181-176118203 CCTTGCAGGGAGGGCAATGCGGG - Intronic
943645249 2:190403146-190403168 CCTTGCGGGGAGGAAATGGAAGG - Intergenic
944534224 2:200693992-200694014 CGTTGCAGGGAGGTGAAGTAGGG - Intergenic
945976258 2:216273562-216273584 CCTGGCAGAGAGTGGGTGGAAGG - Intronic
946301703 2:218828061-218828083 CCCTGCAGGGAGGGGCGGGGAGG + Exonic
946690968 2:222307940-222307962 CCTTGCAGAGAAGGGAGAGAAGG + Intergenic
947090962 2:226510982-226511004 CGTTAAAGGGAAGGGATGGAAGG + Intergenic
947373992 2:229476563-229476585 GCTTGCAGGGATGTTATGGAAGG - Intronic
947541812 2:230985137-230985159 CCTTGCAGGGAGAGGATCCCTGG + Intergenic
947646840 2:231748655-231748677 CCTTGATGGGAGGGGCTGCAGGG - Intronic
948135628 2:235633979-235634001 CTTTGCAGGGAGGGGCTTGCTGG - Intronic
1168893858 20:1310640-1310662 CCTTGGAGGGAGGGGAAGGGAGG + Intronic
1169908913 20:10631160-10631182 CCTTGCATGGAGGGCAAGGCAGG - Intronic
1170209089 20:13829825-13829847 GCTTGGAGGTAGGGGAAGGATGG + Intergenic
1171174373 20:23040432-23040454 CTTTTCAGGGAGGGGTTGGCAGG + Intergenic
1171414497 20:24968449-24968471 ACCTGCAGGGAGGGGAGGAAAGG + Intronic
1172038832 20:32029634-32029656 CCTTTCAGGCAGGGGTTGGGTGG + Intronic
1172146454 20:32761830-32761852 TCTTGAAGGGAGGGGAGGGCAGG - Intergenic
1172840308 20:37898962-37898984 CCTCTCAAGGAGGGGAGGGAGGG + Intergenic
1173790419 20:45824459-45824481 CCTCGGAGGCAGGGGATGGTGGG - Intronic
1173868833 20:46329497-46329519 CCTTGGAGGGAAGGGCTGGCTGG + Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174572216 20:51509910-51509932 CTTTGCAGGGAGGTGAGTGAGGG - Intronic
1174822329 20:53737452-53737474 CCATACAGAGGGGGGATGGAGGG + Intergenic
1175264153 20:57692495-57692517 CCTGGCAGGGAGGGGCTTCAGGG - Intronic
1175415127 20:58795987-58796009 CCCTGCTGGCAGGGGGTGGAGGG + Intergenic
1175423030 20:58847656-58847678 CTTTGCAGGGAGGAGGTGGGTGG - Intronic
1176088407 20:63308345-63308367 CCTTGCAGGTAGGGTCTGGCTGG + Intronic
1177554351 21:22670702-22670724 AATTTTAGGGAGGGGATGGAAGG + Intergenic
1178707925 21:34889845-34889867 CCCGGCAGGGAGGGCGTGGAGGG - Intronic
1179722747 21:43324744-43324766 CCTGGCAGGGAGGAGCTGAAGGG + Intergenic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180158998 21:45990665-45990687 CTTTCCAGGGAGGGTGTGGAGGG + Intronic
1180713818 22:17858169-17858191 CCTTGGCGGGAGGGGGTGGTAGG - Intronic
1181097857 22:20518301-20518323 CCTTGCAGGGATGGAAAGGATGG - Intronic
1181392429 22:22593464-22593486 CAGGGCAGGGAGGGGCTGGAAGG + Intergenic
1181411050 22:22719983-22720005 CGGTGCAGGAAGGGGCTGGAAGG + Intergenic
1181673596 22:24437639-24437661 CCTTGCAGGCAGGGAACTGAGGG - Intronic
1181793642 22:25287042-25287064 CCTTGAAGGCAGGGGATGAGTGG + Intergenic
1181833640 22:25583586-25583608 CCTTGAAGGCAGGGGATGAGTGG + Intronic
1182134671 22:27890234-27890256 GCTTCCAGGGTTGGGATGGAGGG - Intronic
1182479180 22:30595688-30595710 CCTTGCAGGGTCTGGATGCAGGG - Intronic
1183351249 22:37335991-37336013 CAGTGCAGGGAGGGGCTGCAGGG - Intergenic
1183414928 22:37676520-37676542 CTTTGCAGAGAGGGGCTTGAAGG + Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1184514451 22:44953360-44953382 ACTTGCAGGGAGGGGTAGGGAGG - Intronic
1184723573 22:46329978-46330000 CTGTGCAGGGAGGGGAAGGGAGG + Intronic
1185022580 22:48387970-48387992 CCTAGCAGGGAAGGGAGGGAGGG + Intergenic
1185190502 22:49433253-49433275 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190518 22:49433334-49433356 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185190549 22:49433456-49433478 CCCAGCAGGGAGAGGGTGGATGG - Intronic
1185322905 22:50210096-50210118 GGTTTCAGGGAGGGGAAGGATGG + Intronic
949391694 3:3569344-3569366 CCTTACATGGCAGGGATGGATGG - Intergenic
950105864 3:10388027-10388049 CCTGGCCCGGAGGGGAAGGAGGG + Intronic
950457599 3:13101934-13101956 CCTTGCAGGGGTGGGAGGGAGGG + Intergenic
950479507 3:13235780-13235802 GCCTGCAGAGAGGGGAGGGAGGG + Intergenic
950576055 3:13832746-13832768 CCTGACATGGAGGGGATGGCAGG + Intronic
950934215 3:16822340-16822362 CCTTGAAGGGTGGGTATGGATGG + Intronic
951345564 3:21543479-21543501 CCTTGCGGGGCTGGGATGCATGG + Intronic
952278086 3:31896842-31896864 CCTTGGAGGGAGGGGAGGAAAGG + Intronic
952900680 3:38109790-38109812 CCTGGCAGGCAGGAGATGGCAGG + Intronic
952908497 3:38162983-38163005 TTTTGCAGGGAGGAGAGGGATGG - Intergenic
953034075 3:39196611-39196633 ACTTGGAGGGAGGGGCTGGTAGG - Intergenic
953157899 3:40391767-40391789 TGTTGCAGGGAGGGTATGCATGG - Intronic
953505570 3:43482785-43482807 CCTTGCAAGGATGGGTTGCAGGG + Intronic
953613505 3:44468669-44468691 CCTCGGGGGGAGGGGGTGGAGGG - Intronic
953666375 3:44929023-44929045 CCTGCCATGGGGGGGATGGAAGG + Intronic
953886162 3:46715458-46715480 GCTGGCAGGGAGGGGATGACTGG + Intronic
954439699 3:50515101-50515123 CCAGGCAGGGAGGGGATCCATGG + Intergenic
954841708 3:53517191-53517213 CCTTGCAGTGAGGGATTAGAAGG - Intronic
955763411 3:62314633-62314655 AATTTCAAGGAGGGGATGGAAGG - Intergenic
956057061 3:65311117-65311139 CCAGGCAGGAAGGAGATGGAAGG - Intergenic
956507568 3:69958996-69959018 ACTTGCGGGGAAGGGAGGGAGGG + Intronic
957574064 3:81986557-81986579 CCTGGCAGGGAGAGGAGGGGAGG - Intergenic
958547882 3:95578828-95578850 CATTGCTGGGAGGGGAGGGAAGG + Intergenic
958566266 3:95815428-95815450 CATTTCAGGGAGGGGATTGAAGG + Intergenic
958777679 3:98505469-98505491 CCTTCCAGGAATGGGATTGAGGG + Intronic
960256757 3:115518775-115518797 CCTTGATGTGAGGGGAAGGAGGG + Intergenic
960324299 3:116276516-116276538 ACTTGCAGGGAAGGGTGGGAGGG + Intronic
961564124 3:127751279-127751301 CCTTGCTGGGAGGAGCTGCAGGG - Intronic
962250136 3:133830970-133830992 CCCTGTGGGGAGGGGAGGGAAGG + Intronic
962268895 3:133963580-133963602 CTGAGCAGGGAGGGGATGGGTGG - Intronic
963598660 3:147358786-147358808 CCTTGCTGGGAGGGGAATGTGGG + Intergenic
963865072 3:150351435-150351457 CATTGCTGGGTGGGGATGGCAGG + Intergenic
964099305 3:152969529-152969551 CCTGTCAAAGAGGGGATGGATGG - Intergenic
964392650 3:156213628-156213650 CCATGCAGGGTGGGGATTGTTGG + Intronic
965228047 3:166017136-166017158 ACTTGGAGGGAAGGGTTGGAGGG - Intergenic
965671140 3:171149268-171149290 CCTTGCATGGAAGGTAGGGATGG - Intronic
965871013 3:173265341-173265363 GATTTCAGGGAGGGGATAGAAGG + Intergenic
966958187 3:184906841-184906863 GATTTCAGGGAAGGGATGGAAGG + Intronic
968228917 3:196992843-196992865 GCTGGCTGGGAGGGGATGCAGGG - Intronic
968765355 4:2465564-2465586 CTGTGCAGGGAGGGGAGGCAGGG - Intronic
968765379 4:2465636-2465658 CTGTGCAGGGAGGGGAGGCAGGG - Intronic
969308125 4:6336935-6336957 ACAGGCAGGGAGGGGTTGGAGGG - Intronic
969345026 4:6564694-6564716 CCTTCCTGGGAGGGGAGGGTAGG - Intergenic
969513185 4:7631388-7631410 CCAGGCAGGGAGGGGGTGGGAGG + Intronic
969867397 4:10084754-10084776 CCTTGGAGGGAGGGGAATGAAGG - Intronic
971151821 4:24041279-24041301 CCCAGCAGGGAGGAGTTGGAGGG - Intergenic
977268661 4:94887021-94887043 CTTTTCAGGGAGGGGATAAAAGG + Intronic
977397315 4:96486770-96486792 CTGTTCAGGGAGGGGATGGAAGG + Intergenic
981093260 4:140755265-140755287 CCTTGAAGGGAGGGGGTTTAGGG + Intronic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
982096768 4:151930542-151930564 CCTAACAGGAAGGGGAAGGAAGG - Intergenic
983546529 4:168970635-168970657 CCTTGCAGGGAAGGGTGGGAGGG - Intronic
984419129 4:179496976-179496998 AGTTGTAGGGAGGGGATTGAGGG + Intergenic
984952032 4:185015118-185015140 GCTTGGGGGCAGGGGATGGATGG - Intergenic
985069010 4:186150242-186150264 CCTTGGAGGGAGGGGGAGGGAGG - Intronic
985278994 4:188268793-188268815 ACTTGGAGGAAGAGGATGGAAGG + Intergenic
985548550 5:521917-521939 GCTGGCAGAGAGGGGATGGAGGG + Intronic
985880838 5:2637904-2637926 CCCTGCAGTGTGGAGATGGACGG - Intergenic
985926696 5:3024827-3024849 CCTTGAAGGGAGAGGACGGCTGG - Intergenic
989262243 5:39431053-39431075 TGTTGCAGGGTGGGGAGGGAGGG + Intronic
990468399 5:56090693-56090715 CCTTGCAGTGAGGTGAGGCATGG - Intergenic
990495855 5:56347055-56347077 GATTTTAGGGAGGGGATGGAAGG - Intergenic
992791789 5:80220573-80220595 CCTTGCAGGGGAAGGAAGGAGGG - Intronic
992895268 5:81240039-81240061 CATTGGAGGGAGGGGAAAGAGGG - Intronic
993701473 5:91123868-91123890 CCTAGCAGGGAGTGGAGGGTGGG + Intronic
994645520 5:102464032-102464054 ACTTGCAGGGAAGGGTAGGATGG + Intronic
995269975 5:110208897-110208919 CCTTGAAGGGGGAGGATGGGAGG - Intergenic
995530888 5:113090993-113091015 CGTGGGAGGGAGGAGATGGAGGG + Intronic
996594348 5:125184474-125184496 CCTCGCAGGTGGGGGGTGGAAGG - Intergenic
997021130 5:130002827-130002849 CCTTTTTGGGAGGGGCTGGAGGG + Intronic
997236608 5:132275643-132275665 ACTGGAAGGGATGGGATGGAGGG - Intronic
997376526 5:133401468-133401490 TATTGCAGGCAGGGGGTGGAGGG - Intronic
997622288 5:135306745-135306767 AAAGGCAGGGAGGGGATGGATGG - Intronic
998912915 5:146980410-146980432 ACTAGCAGGGAGGGGAGGGATGG - Intronic
1000253732 5:159518806-159518828 ACCTGCGGGGAGGGGATAGATGG + Intergenic
1000535165 5:162470328-162470350 TCTTCCAGGGAGGAGATGGTAGG - Intergenic
1000883259 5:166721239-166721261 GGGTGCAGGGAGGAGATGGAGGG - Intergenic
1001705078 5:173735649-173735671 CCCGGCAGGGAGGGCAAGGAAGG + Intergenic
1002134793 5:177100886-177100908 GCTGGCAGGGAGGGGGTGCAGGG - Intergenic
1002536044 5:179876111-179876133 CCTTGCAGGGAGGGGTGGCTGGG - Intronic
1002589878 5:180283148-180283170 TCTAGCAGGAAGGGGAAGGAAGG - Intronic
1003098888 6:3162537-3162559 CCAGGGAGGGAGGGGAAGGAGGG - Intergenic
1003138930 6:3455986-3456008 CCTTGTCCGGAGGGGATGGCAGG + Exonic
1003329878 6:5121104-5121126 CATTGCAGGGCAGGGGTGGAGGG - Intronic
1004152130 6:13131438-13131460 ACTTGCGGGGAAGGGTTGGAGGG + Intronic
1006472902 6:34238065-34238087 TTTTGCGGGGAGGGGACGGAGGG + Intronic
1007301562 6:40871739-40871761 CCTTGGAGAGAGGTGCTGGAGGG - Intergenic
1011620399 6:89237326-89237348 GCTTCCAGGGTGGGGAGGGAAGG + Intergenic
1012671321 6:102051304-102051326 GCTTGCAGAGAGTGGAAGGAAGG - Intronic
1014035083 6:116757671-116757693 CCTGGCAGGCAGAGGATGCAGGG + Intronic
1015594224 6:134850936-134850958 TTTTGCAGGGAAGGGGTGGAGGG - Intergenic
1016019081 6:139216857-139216879 ACTTGCAGGGAAGAGTTGGAGGG + Intergenic
1016041026 6:139432043-139432065 GCTTGCAGTTAGGGGATGGGAGG + Intergenic
1016528448 6:145030969-145030991 CCTTCCAGGGGTGGGGTGGAAGG - Intergenic
1016825318 6:148382817-148382839 TTTTGGAGAGAGGGGATGGAAGG + Intronic
1018154783 6:160975506-160975528 CCTTTCTGGGAGGAGAAGGAAGG - Intergenic
1018719284 6:166560666-166560688 GCTTGGTGGGAGGGGAGGGAGGG + Intronic
1018726466 6:166616650-166616672 CCTGGCAGAGGGAGGATGGATGG - Intronic
1019006275 6:168799261-168799283 CCTTGCAGCCGGGGGATAGAGGG - Intergenic
1019103537 6:169650596-169650618 GCATGGATGGAGGGGATGGAGGG - Intronic
1019437157 7:1028205-1028227 GGCTGCAGGGAGGGGATGGGAGG - Intronic
1019518549 7:1450328-1450350 CCACGAAGGGAGGGGCTGGAGGG + Intronic
1019779381 7:2930504-2930526 CCTGGCGGGGAGGGGGTGGTGGG + Intronic
1022787257 7:33650826-33650848 CCTTGCTGGGGATGGATGGATGG + Intergenic
1024541537 7:50479203-50479225 TCTAGCAGGGAGGGGATGAGTGG - Intronic
1024658339 7:51471321-51471343 CCTGTGAGGGAGGGGAAGGAGGG - Intergenic
1024930474 7:54663219-54663241 CCAAGCAGGGAGGCTATGGATGG - Intergenic
1024953628 7:54892345-54892367 CCTGGGATGGAGGAGATGGAGGG - Intergenic
1025145206 7:56495814-56495836 GCTTGCAGGGATGGGCAGGAGGG + Intergenic
1025260814 7:57416310-57416332 CCTTGCAGGGATGGGCAGAAGGG + Intergenic
1026464200 7:70639860-70639882 CCTCTCAGAGAGGGAATGGAGGG - Intronic
1026501840 7:70949200-70949222 CATTGCAAGCAGGGGGTGGAGGG - Intergenic
1029421101 7:100472294-100472316 CCTGGCAGGGTGGGGCTTGAGGG + Intronic
1029422752 7:100479461-100479483 TCTTGCAGGGAGGGGCTGCAGGG + Intergenic
1030531464 7:110716209-110716231 TCTTGAAGAGAGGGGATGGATGG + Intronic
1031077468 7:117226696-117226718 CCTTGCAGGTATGGGATGGAAGG + Intronic
1031121411 7:117726714-117726736 CCTTGGAGGGATGGGAAGGGGGG + Intronic
1031265426 7:119573686-119573708 CCTTGCAGGCATGGGATCCAGGG + Intergenic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1032083794 7:128873196-128873218 CTTTGCATGGAGGGGAAGCAGGG - Intronic
1032268581 7:130384713-130384735 CCCTGCAGTGAGGGGAGGGTTGG + Intronic
1032745578 7:134783131-134783153 CCTTGTAGGAAGGGCAAGGAAGG + Intronic
1032986538 7:137343699-137343721 CCTGACAGGGAGGGAACGGAAGG + Exonic
1034672176 7:152867236-152867258 CCTTGCAGAGCGGGCTTGGAGGG - Intergenic
1034940045 7:155224791-155224813 CCATCCAGGGAGGGGCTGGGAGG + Intergenic
1035037290 7:155903643-155903665 GGTCGCAGGGAGGGGATGGTAGG - Intergenic
1035158732 7:156935456-156935478 GCCTGCAGGGAGGAGGTGGAAGG + Intergenic
1035852422 8:2933766-2933788 CCTGGCAGGGAGTGGGTTGACGG + Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037319589 8:17630639-17630661 CCCAGCAGGGAGGGGAGGGGAGG - Intronic
1037654205 8:20868896-20868918 CATGGCAGGGAGGGAGTGGAGGG - Intergenic
1038466769 8:27772046-27772068 CCTTTCAGGAAGGGGTTGTAGGG - Intronic
1038611263 8:29061839-29061861 CAGTGCAGGGTGGGGAGGGATGG - Intronic
1039496635 8:37985551-37985573 GCTGGCAGGCTGGGGATGGAGGG + Intergenic
1039598894 8:38816871-38816893 CCTTCCAGGGAGGGGAGAAAGGG - Intronic
1039755595 8:40518788-40518810 CCTGGCAGGGAGGAGAGGGCTGG - Intergenic
1041360378 8:57046796-57046818 CTTTGCTGTGAGGGGATGGAAGG - Intergenic
1041606543 8:59788446-59788468 GACTTCAGGGAGGGGATGGAAGG - Intergenic
1042046873 8:64663136-64663158 TCTAGCAAGGAGAGGATGGAGGG - Intronic
1042176624 8:66043553-66043575 CCCTGCATGGGGGGGAAGGATGG + Exonic
1044325404 8:90852586-90852608 CTTTACAGGCAGAGGATGGAGGG - Intronic
1044821935 8:96160861-96160883 CCTCGCCGGGAGGGGAGGAATGG + Intergenic
1046124077 8:109882370-109882392 CCATGAGGGGAGGTGATGGATGG + Intergenic
1049197657 8:141324525-141324547 CATGGCAGCGAGGGGAGGGAGGG - Intergenic
1049425807 8:142537439-142537461 CTTTCCTGGGTGGGGATGGAGGG - Intronic
1049473052 8:142784735-142784757 CCTTCCAGGGTGGGGACGGACGG + Intergenic
1052055272 9:23898935-23898957 AATTTCAGGGAGGGGATCGAAGG - Intergenic
1052762607 9:32608174-32608196 GCTTGCAGGGTGGGGAGTGAGGG - Intergenic
1052911961 9:33890806-33890828 TCTTGCAGGGACGGGGTGGTTGG + Intronic
1053200621 9:36149463-36149485 CCTTGGAGGGAGGGGTGGGTAGG - Intronic
1055649335 9:78392055-78392077 AATTTCAGGGAGGGAATGGAAGG - Intergenic
1056580678 9:87886533-87886555 CTTTGCAGGGAAGGGCAGGAAGG + Exonic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1059506866 9:114807176-114807198 CCCTGCAGTGAGGGGGTTGAGGG + Intergenic
1059718374 9:116934607-116934629 CCTTTCAGGGAGTGGAAGGTGGG + Intronic
1060192874 9:121604072-121604094 CCTTGCAAGAAGGTGATGGTGGG + Intronic
1060206410 9:121685158-121685180 CCGTGAAGGGCAGGGATGGAGGG - Intronic
1060243563 9:121925596-121925618 CCTTCCTGGGAGGGTCTGGAGGG - Intronic
1060557239 9:124514295-124514317 GCATGCAGGGAGGGCAAGGATGG + Intergenic
1060729447 9:126027828-126027850 TCTTGCAGGGAGGGGAGAGGAGG + Intergenic
1060979361 9:127783873-127783895 ACTACCAGGGAGGGGCTGGAAGG - Intergenic
1061945221 9:133904947-133904969 CCTGGCAGGGAGGGGATGCAGGG + Intronic
1061964114 9:134003606-134003628 CCTTGCACAGGGTGGATGGATGG - Intergenic
1062023565 9:134330257-134330279 CCTGGCAGAGAAGGGAAGGAGGG - Intronic
1062046199 9:134425595-134425617 CCTTGCTGGGCTGGGAGGGAGGG + Intronic
1062091562 9:134681153-134681175 CCTTGCAGGGAGGGCTGGGGTGG + Intronic
1062218748 9:135403217-135403239 CGTGGCCGGGAGGGGAAGGAGGG - Intergenic
1062681530 9:137784676-137784698 CCTGGCAGGGGGGTGAGGGAGGG + Intronic
1185749331 X:2598137-2598159 CCTTGAAAGGAAAGGATGGATGG + Intergenic
1185908417 X:3959587-3959609 CCTTTCAGAGAGTGGAGGGAGGG - Intergenic
1187561330 X:20406353-20406375 CCCTGCAGGGATGGGGTTGAAGG - Intergenic
1188667809 X:32846166-32846188 CCTTGCAAGGCGGGGATTAAAGG - Intronic
1188987466 X:36780372-36780394 CCTTGCAGGGAGTGCATAGGTGG - Intergenic
1189121387 X:38398993-38399015 CTTGGCAGGGAGGGAATTGAGGG - Intronic
1190405937 X:50087694-50087716 CCCTGTATTGAGGGGATGGATGG - Intronic
1190728916 X:53211772-53211794 CCGTGCATGTAGGTGATGGAGGG - Exonic
1191595250 X:62936403-62936425 CTTGGCAGAGAGGGGATGCAAGG + Intergenic
1192668534 X:73114210-73114232 AATTACAGGGAGGGAATGGAAGG - Intergenic
1193637355 X:83968967-83968989 CCTGGCAGGGTGGGGGTGGGTGG - Intergenic
1195065953 X:101238476-101238498 CCTTTGTGGGAGGGGAGGGAGGG + Intronic
1196591666 X:117492511-117492533 CTTTGTAGGGATGGGATTGAGGG - Intergenic
1196599548 X:117585709-117585731 CCACACAGGGAGGGGATGCAGGG + Intergenic
1196893025 X:120308764-120308786 GGTTGCTGGGAGGGGATGGGGGG + Intronic
1198728341 X:139700693-139700715 CATTGAAGGGAAGGGAAGGAAGG - Intronic
1198942399 X:141971002-141971024 CCTTCTAGGGATGGGATAGATGG - Intergenic
1199503735 X:148538026-148538048 CCTTGAGGGGAGGGGAAGGATGG - Intronic