ID: 903768253

View in Genome Browser
Species Human (GRCh38)
Location 1:25748483-25748505
Sequence CAGGGTGAACACAGGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 331}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903768253_903768272 26 Left 903768253 1:25748483-25748505 CCCTGTGTCCTGTGTTCACCCTG 0: 1
1: 0
2: 4
3: 32
4: 331
Right 903768272 1:25748532-25748554 TGCAGCTGAGGAAATGGGGCAGG 0: 1
1: 0
2: 6
3: 69
4: 474
903768253_903768271 22 Left 903768253 1:25748483-25748505 CCCTGTGTCCTGTGTTCACCCTG 0: 1
1: 0
2: 4
3: 32
4: 331
Right 903768271 1:25748528-25748550 CTTCTGCAGCTGAGGAAATGGGG 0: 1
1: 0
2: 2
3: 54
4: 475
903768253_903768264 14 Left 903768253 1:25748483-25748505 CCCTGTGTCCTGTGTTCACCCTG 0: 1
1: 0
2: 4
3: 32
4: 331
Right 903768264 1:25748520-25748542 GCAGCCCCCTTCTGCAGCTGAGG 0: 1
1: 0
2: 1
3: 49
4: 343
903768253_903768273 27 Left 903768253 1:25748483-25748505 CCCTGTGTCCTGTGTTCACCCTG 0: 1
1: 0
2: 4
3: 32
4: 331
Right 903768273 1:25748533-25748555 GCAGCTGAGGAAATGGGGCAGGG 0: 1
1: 1
2: 5
3: 53
4: 534
903768253_903768261 -8 Left 903768253 1:25748483-25748505 CCCTGTGTCCTGTGTTCACCCTG 0: 1
1: 0
2: 4
3: 32
4: 331
Right 903768261 1:25748498-25748520 TCACCCTGCACGGGAGGGGTTGG 0: 1
1: 0
2: 1
3: 19
4: 157
903768253_903768270 21 Left 903768253 1:25748483-25748505 CCCTGTGTCCTGTGTTCACCCTG 0: 1
1: 0
2: 4
3: 32
4: 331
Right 903768270 1:25748527-25748549 CCTTCTGCAGCTGAGGAAATGGG 0: 1
1: 0
2: 7
3: 68
4: 657
903768253_903768268 20 Left 903768253 1:25748483-25748505 CCCTGTGTCCTGTGTTCACCCTG 0: 1
1: 0
2: 4
3: 32
4: 331
Right 903768268 1:25748526-25748548 CCCTTCTGCAGCTGAGGAAATGG 0: 1
1: 0
2: 6
3: 103
4: 711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903768253 Original CRISPR CAGGGTGAACACAGGACACA GGG (reversed) Intronic
901639185 1:10684789-10684811 CTGGGTGAACTGATGACACAGGG + Intronic
902580574 1:17405039-17405061 CAGGGTGGCCACAGGTCACATGG + Intergenic
902663233 1:17920062-17920084 ATGGGTGGACACAGGACAGAGGG - Intergenic
903768253 1:25748483-25748505 CAGGGTGAACACAGGACACAGGG - Intronic
905969010 1:42126709-42126731 CAGGGTGAAGGGAGGAAACAGGG - Intergenic
906074343 1:43041137-43041159 GAGTGTGAACTCAGGATACAGGG + Intergenic
909310268 1:74137890-74137912 CAATGAGAACACAGGACACAGGG + Intronic
914849263 1:151302006-151302028 CAGGGTGAGGACAAGAGACATGG + Intronic
915279844 1:154814935-154814957 CTGGATGATCACAGCACACAAGG - Intronic
915597583 1:156904349-156904371 CAGGGGGAGCAAAGGAAACAGGG + Intronic
919584403 1:199418270-199418292 CATTGAGAACACAGGACACAGGG - Intergenic
920844984 1:209586069-209586091 CAGGCTGAACTCAGGACGAAGGG - Intronic
921670371 1:217918061-217918083 CAGTGTGGACAGATGACACAAGG - Intergenic
923341210 1:233008618-233008640 CAAGGTGAACACTGGACACTGGG - Intronic
923954374 1:238997979-238998001 CAACGAGAACACTGGACACAGGG - Intergenic
1063849198 10:10164842-10164864 CAGGGTGATCACATGTCACCTGG + Intergenic
1063957517 10:11280690-11280712 CAGGATGGACAGAGGACACATGG + Intronic
1066249978 10:33623976-33623998 CAGTGTGAACAGTGGACAAAAGG + Intergenic
1067419367 10:46133478-46133500 CTGGGGGGACACAGGGCACAAGG - Intergenic
1067426631 10:46215919-46215941 CTGGGGGAACACAGCGCACAAGG + Intergenic
1067504718 10:46840075-46840097 CTGGGGGGACACAGGGCACAAGG - Intergenic
1068232447 10:54187015-54187037 CAGGATGAACACAAAACAAATGG - Intronic
1068602266 10:58968454-58968476 CAGGGTGAAAAAAAGAAACAGGG + Intergenic
1068812234 10:61269173-61269195 CAGGGTGAAGTCAAGAAACAGGG + Intergenic
1069317008 10:67117685-67117707 CATGGTGATCACAAGATACAAGG + Intronic
1069627988 10:69880203-69880225 CAGTGAGAACACAGGACATGGGG - Intronic
1070962157 10:80506897-80506919 CAGTTTGACCACAGGCCACAGGG + Intronic
1071430559 10:85603262-85603284 CAGGGAGGACACAGGTCACTGGG - Intronic
1072630087 10:97139799-97139821 CAGTGTGCACACAGGGCACTGGG + Intronic
1073732240 10:106303013-106303035 GTGGGTGAACAAAAGACACAGGG - Intergenic
1075083629 10:119399911-119399933 CAGCCTGAACAAAGGCCACAAGG - Intronic
1075139115 10:119815727-119815749 GAGGTAGAACACAGGACACAAGG + Intronic
1075640183 10:124059076-124059098 TAGGCTGAACACCGGCCACACGG + Intronic
1076153510 10:128184644-128184666 GAGGGTGAACGCAGCTCACAAGG - Intergenic
1077035990 11:494775-494797 CAGGCTGCACACAGGCCAGAAGG + Exonic
1077280738 11:1744182-1744204 GTGGGTGGACAGAGGACACATGG - Intronic
1077849524 11:6062119-6062141 GAGGTTGAACAGAGGACTCAGGG - Intergenic
1078279862 11:9890621-9890643 CAGGGTAAACACAGGCTATAAGG + Intronic
1079904223 11:26224543-26224565 CAGTGTGCACACAGGGCATAAGG - Intergenic
1082068915 11:47922884-47922906 CAGGGTCAACAGAGCAGACAGGG - Intergenic
1082927452 11:58564998-58565020 CAGAGTGAACCAAGGACACAGGG + Intronic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084312903 11:68327015-68327037 CAGGGCGAAGGCAGGACACGTGG - Intronic
1084356930 11:68645309-68645331 TGGGGTGAGCACAGAACACACGG + Intergenic
1084474098 11:69378918-69378940 CCGGGTGAGCCCTGGACACAGGG + Intergenic
1084569154 11:69949201-69949223 CAAACTGAACAGAGGACACAGGG + Intergenic
1085531622 11:77195257-77195279 CAGGGAGCACTCAGGACTCAGGG - Intronic
1085667009 11:78422908-78422930 CAACGAGAACACAGGACACAGGG + Intergenic
1085768219 11:79302680-79302702 CAAGGTGAACTCAGGGAACAGGG - Intronic
1087365283 11:97211028-97211050 TAGTGTGATCACAGGATACAAGG - Intergenic
1088247693 11:107835205-107835227 CAGGCTGAACACAGTACACCTGG + Intronic
1090428406 11:126626444-126626466 CAGAATGCACACAGGCCACAGGG + Intronic
1092731612 12:11540203-11540225 CAGGAAGAACACTGGAAACAAGG - Intergenic
1094790597 12:33909522-33909544 CAGTGTGATCACAGGACTCCTGG + Intergenic
1095133555 12:38571480-38571502 CCAAGTAAACACAGGACACAAGG + Intergenic
1095344930 12:41139180-41139202 CACTGAGAACACAGGACACAGGG + Intergenic
1095965329 12:47863629-47863651 CAGGATAAACACAGGAGCCAGGG + Intronic
1096228550 12:49884623-49884645 CAGGCTGGGCACAGGACACCTGG + Intronic
1098194278 12:67983456-67983478 CAGGGTGTGCAGAGGTCACATGG - Intergenic
1098753598 12:74328081-74328103 CAGGGAGAAAACAGCACAAAAGG - Intergenic
1098851430 12:75600864-75600886 CAGGGACAGCACAGGACAGAAGG + Intergenic
1099530013 12:83766877-83766899 CATGATTAAAACAGGACACAAGG - Intergenic
1100871834 12:98917746-98917768 CTGCGTGAACAAAGGACAAATGG + Intronic
1101200231 12:102427809-102427831 CAGATTGAACACAGGAGAGAGGG + Intronic
1103380639 12:120491516-120491538 TAGGGTGGTCACAGGACTCATGG + Intronic
1103725180 12:122994299-122994321 CAGGCTGATCCCAGGGCACAGGG + Intronic
1103905078 12:124323055-124323077 GAGTGTGAACACCTGACACATGG + Intergenic
1103905103 12:124323254-124323276 GAGTGTGAACACCTGACACATGG + Intergenic
1103905116 12:124323355-124323377 GAGTGTGAACACCTGACACATGG + Intergenic
1103905131 12:124323456-124323478 GAGTGTGAACACCTGACACATGG + Intergenic
1103905146 12:124323555-124323577 GAGTGTGAACACCTGACACATGG + Intergenic
1103905182 12:124323813-124323835 CGGTGTGAACACCTGACACATGG + Intergenic
1104380011 12:128299101-128299123 AAGGTTGAACACAGGGCTCAGGG - Intronic
1104969411 12:132524419-132524441 CAGGGTGCACACAAGGCAGACGG - Intronic
1105467834 13:20663270-20663292 CAGCGTGAGGACAGGACACATGG + Intronic
1105810456 13:23990731-23990753 CTGGGTGATCACGGGAAACAAGG - Intronic
1106621588 13:31375950-31375972 CAGTGTGTACAAAGCACACAAGG - Intergenic
1108208146 13:48111999-48112021 CAGGGTGGCCCCAGGAAACAGGG + Intergenic
1108414959 13:50188406-50188428 CAGGATGAGAGCAGGACACAGGG + Intronic
1108465252 13:50708562-50708584 CAGTGTGAAGAAAGGAGACAGGG + Intronic
1108785839 13:53900272-53900294 TAATGAGAACACAGGACACATGG + Intergenic
1112175430 13:97018771-97018793 CAGGGTGAGCACAGGGCCCAGGG - Intergenic
1113048708 13:106184931-106184953 CAGGATGAGCACATGACCCAAGG + Intergenic
1117767570 14:59098859-59098881 AAGGGTCAACACTGGAGACATGG - Intergenic
1118820330 14:69341421-69341443 CAGGGTGAGCACAGACCATACGG - Intronic
1118909164 14:70046835-70046857 CAGGGTGAACTGTGGACTCAAGG + Intronic
1120099778 14:80431500-80431522 AAGGGTGAACAAAGTAGACAGGG - Intergenic
1120100697 14:80441864-80441886 AAGAGTAATCACAGGACACAAGG + Intergenic
1120495353 14:85227640-85227662 CAGGGTGTCCACAGGACATGTGG + Intergenic
1121463983 14:94102441-94102463 GAGGGTGAGCACAGGGCACAGGG - Intronic
1122027102 14:98886047-98886069 CAGGGTGACCACAGGCTGCAGGG + Intergenic
1122267775 14:100554686-100554708 CAGGGTGAGAACAGGAGACCTGG - Intronic
1123137770 14:106045391-106045413 CAGGGGGCACTCAGGACACCAGG - Intergenic
1123146831 14:106141330-106141352 CAGGGGGTACTCAGGACACCAGG - Intergenic
1123187075 14:106530520-106530542 CAGGGGGCACTCAGGACACCAGG - Intergenic
1123223594 14:106879320-106879342 CAGGGGGCACTCAGGACACCAGG - Intergenic
1124035808 15:26052829-26052851 CAGGATGAGGACAGGACACAGGG - Intergenic
1124252612 15:28116932-28116954 CAGGGAGCACAGAGGCCACATGG - Intronic
1124631630 15:31340978-31341000 CAGGATGAACACAGGGCACAGGG - Intronic
1124723349 15:32132751-32132773 CAGGGTTAAATCAGGTCACAGGG - Intronic
1126653452 15:50950814-50950836 CAATGAGAACATAGGACACACGG - Intronic
1126789101 15:52204519-52204541 GGGGGAGAACACAGGAAACAAGG - Intronic
1126867059 15:52948114-52948136 CAGGGAGAACTCAGGACACCAGG + Intergenic
1128342825 15:66834682-66834704 CAGGCTGAAGACAGGATCCAAGG + Intergenic
1128751779 15:70155287-70155309 CAGGGAGAACACGCGCCACAGGG - Intergenic
1129181802 15:73882413-73882435 AAGGGTGAACCAAGGACAGAGGG - Intronic
1130997553 15:88912383-88912405 CAGGCAGATCACAGGACATAGGG + Intronic
1131324049 15:91425326-91425348 CAGGGTGAACACAGCAAACATGG - Intergenic
1131327616 15:91463516-91463538 CAGGGAGCACGCAGGTCACATGG - Intergenic
1131411756 15:92213314-92213336 CATGGAGAAAACAGAACACAGGG + Intergenic
1132867993 16:2103324-2103346 CAGGGTGACCACAGCACCGACGG + Exonic
1133293798 16:4740187-4740209 CTGGGTGCAGACAGAACACAAGG + Exonic
1133452964 16:5918956-5918978 TGGGGTGAACAGTGGACACAAGG + Intergenic
1133842000 16:9418384-9418406 CAGAGAGACCACAGGAGACAGGG - Intergenic
1134523778 16:14929790-14929812 CAGGGTGACCACAGCACCGACGG - Intronic
1134549124 16:15131145-15131167 CAGGGTGACCACAGCACCGACGG + Intronic
1134711369 16:16328275-16328297 CAGGGTGACCACAGCACCGACGG - Intergenic
1134719219 16:16371578-16371600 CAGGGTGACCACAGCACCGACGG - Intergenic
1134948207 16:18340307-18340329 CAGGGTGACCACAGCACCGACGG + Intergenic
1134955460 16:18380418-18380440 CAGGGTGACCACAGCACCGACGG + Intergenic
1136691956 16:32039167-32039189 CAGGGGGCACTCAGGACACTGGG + Intergenic
1136692058 16:32039508-32039530 CAGGGGGCACTCAGGACACTTGG + Intergenic
1136692233 16:32040199-32040221 CAGGGGGTACTCAGGACACCAGG + Intergenic
1136700542 16:32135718-32135740 CTGGGTCAACAAAGTACACATGG + Intergenic
1136792540 16:32982729-32982751 CAGGGGGCACTCAGGACACTGGG + Intergenic
1136792601 16:32982946-32982968 CAGGGGGCACTCAGGACACTTGG + Intergenic
1136877255 16:33871108-33871130 CAGGGGGCACTCAGGACACTTGG - Intergenic
1138415640 16:56869994-56870016 GAGGGTGGCCACAGGACCCACGG - Intronic
1140484461 16:75282744-75282766 CAGGGACAACTCAGGACACCGGG + Intergenic
1140706613 16:77636560-77636582 GGGTGTGAACACAGGACCCAGGG + Intergenic
1141887294 16:86901353-86901375 CATGGAGAACACAGGAGTCAGGG + Intergenic
1142283617 16:89161764-89161786 CAGGGTGGGCACAGGACCCCAGG + Intergenic
1142289125 16:89184718-89184740 CAGGCTGAACAGAGGACACACGG - Intronic
1203094746 16_KI270728v1_random:1244194-1244216 CAGGGGGCACTCAGGACACTGGG + Intergenic
1203094816 16_KI270728v1_random:1244425-1244447 CAGGGGGCACTCAGGACACTTGG + Intergenic
1203094986 16_KI270728v1_random:1245116-1245138 CAGGGGGTACTCAGGACACCAGG + Intergenic
1142746226 17:1959994-1960016 CACGGTGAACACAGGACAATCGG - Intronic
1143575161 17:7788030-7788052 CAGGGTGGCTCCAGGACACAAGG + Intronic
1144247130 17:13378065-13378087 AATGTTGAACACAGGACACTTGG - Intergenic
1145276121 17:21431881-21431903 CAGTGTGCACAGAGGTCACAGGG - Intergenic
1145313965 17:21717795-21717817 CAGTGTGCACAGAGGTCACAGGG - Intergenic
1145712410 17:26989772-26989794 CAGTGTGCACAAAGGTCACAGGG - Intergenic
1146673094 17:34755507-34755529 CAGAGCAACCACAGGACACATGG + Intergenic
1147920850 17:43916131-43916153 CAGGGTGAGAACAAGACAAAAGG + Intergenic
1147930151 17:43974454-43974476 CTGGGTGAACAATTGACACAGGG - Intronic
1148166076 17:45484928-45484950 CAGAGGGCAAACAGGACACAGGG + Intronic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1149487080 17:57050898-57050920 CTGAGTGAACACAGGAGACATGG - Intergenic
1149661897 17:58338385-58338407 GTGGGTGAACACAGGAGGCATGG + Intergenic
1149985912 17:61346990-61347012 AAGGGGCAAAACAGGACACAGGG - Intronic
1150397299 17:64831652-64831674 CAGAGGGCAAACAGGACACAGGG + Intergenic
1150501829 17:65658536-65658558 CTGGGTGTAAGCAGGACACAAGG + Intronic
1150869990 17:68896557-68896579 CAGTGTGGACACAGAAGACAAGG - Intronic
1152234408 17:79130984-79131006 CACGGGGCACACAGTACACATGG - Intronic
1152234422 17:79131080-79131102 CACGGGGCACACAGCACACACGG - Intronic
1152478227 17:80532379-80532401 CAGAGTGAACACTGGCCCCAAGG - Intergenic
1152573302 17:81129775-81129797 CAGGGTCAGCACAGGGCTCAGGG + Intronic
1152750656 17:82061016-82061038 CAGGCTGAGCACTGGGCACACGG + Intronic
1153300272 18:3586127-3586149 CAGGGAGAATACTGGAGACATGG + Intronic
1154004176 18:10512670-10512692 CAGGGAGAACTCAGGAGAGAGGG - Intergenic
1154106381 18:11527338-11527360 ACCTGTGAACACAGGACACAGGG + Intergenic
1155186115 18:23388014-23388036 CAGGTTAATCACATGACACATGG + Intronic
1155276427 18:24192301-24192323 CAGGGTACACACAGGACATGAGG + Intronic
1156688672 18:39680126-39680148 CAGAGTCCACACAGGACAAAAGG - Intergenic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1156942326 18:42783577-42783599 GAGGCTGGACAGAGGACACAAGG + Intronic
1157420673 18:47545219-47545241 CAGGGAGTACACAGATCACAAGG + Intergenic
1157810977 18:50695602-50695624 CAGGGTGATGACAAGACAGAAGG + Intronic
1158097941 18:53796091-53796113 CAGGCTGCACACAGGATCCAAGG + Intergenic
1158432544 18:57402421-57402443 CATGGTGAACACACCACATATGG + Intergenic
1160144526 18:76352577-76352599 CAGGGTCAACACAGAGGACAAGG + Intergenic
1160537952 18:79604918-79604940 CAGGGGGACCACAGGCCTCAGGG + Intergenic
1161864887 19:6826586-6826608 CAGGGAGAAGACAGGCCACCAGG - Intronic
1162095849 19:8309551-8309573 CAGGGTGTGCAGAGGCCACAAGG - Intronic
1162490896 19:10990964-10990986 CAGGGCGAGCACAGGACAGAAGG - Intronic
1162821007 19:13223681-13223703 AGGGGTGAACACAGGACACCCGG - Intronic
1162916451 19:13876966-13876988 CCGGGGGACTACAGGACACAGGG - Intronic
1163268215 19:16234067-16234089 CAGGATGAGCACAGGCCTCAGGG - Intronic
1163717715 19:18881593-18881615 CAGGGTGAATCCAGGACCCTCGG - Intronic
1164902118 19:31937330-31937352 CAGTGTTAACACATGACTCAAGG + Intergenic
1164906483 19:31972572-31972594 CCAGATGAACACAGGGCACACGG + Intergenic
1165198843 19:34129101-34129123 CAGGGTAACCACAGGACAAGGGG + Intergenic
1165241518 19:34472156-34472178 CAGGGTGAGGACAGGGCACGCGG - Intergenic
1166432912 19:42741731-42741753 CAGGGAGCAGGCAGGACACAGGG + Intronic
1167331313 19:48858235-48858257 CAAGGTGAACTGGGGACACAAGG + Intronic
1167446305 19:49539630-49539652 CAGGGAGAACTCAGAACTCAGGG - Intronic
1168168439 19:54571142-54571164 CAGGGCCAACACAGGACATTGGG + Intergenic
1168181634 19:54665910-54665932 CAGGGAAAACACAGGACATTGGG + Exonic
1168355625 19:55698066-55698088 CAGGGTGATCAGAGGTCACCTGG + Intronic
926315244 2:11704863-11704885 CTGGGTGAACACTGGACACTGGG + Intronic
926433324 2:12813341-12813363 CAGGGAAAACACACCACACATGG - Intergenic
926498258 2:13618568-13618590 CAGTGTCAATATAGGACACATGG + Intergenic
927374294 2:22395559-22395581 CAGGGTGAACAAAAGATAGAAGG + Intergenic
927856401 2:26530329-26530351 CAGGGAGGGCACAGGAGACAGGG + Intronic
928061683 2:28119827-28119849 CAGGGTGAGCCCAGGACACCAGG - Intronic
928669703 2:33589241-33589263 CAGGCTGAAATCAGCACACAAGG - Intronic
929000970 2:37346217-37346239 CATGGAGACCACAGGCCACAGGG + Intronic
930022122 2:47007885-47007907 CAGGGAGAATTCAGAACACAGGG + Intronic
930672416 2:54164904-54164926 CAATGAGAACACATGACACAGGG - Intronic
931424420 2:62157885-62157907 GAGAGAGAACACAGGCCACAGGG - Intergenic
933035636 2:77393996-77394018 CAGGTTAAATATAGGACACATGG - Intronic
933456349 2:82524719-82524741 GAGGGAGAGCACAGGACAAAAGG + Intergenic
933548294 2:83741833-83741855 CAGGTTCACCCCAGGACACATGG + Intergenic
934681737 2:96288589-96288611 CAGGATGCACACAGCACACAGGG + Intronic
935512767 2:103996223-103996245 CAATGAGAACACTGGACACAGGG + Intergenic
935557327 2:104524355-104524377 GAGGTTGGACACAGGACACTCGG + Intergenic
936267816 2:111023697-111023719 CAGAGTGGGCACAGAACACAGGG + Intronic
938641300 2:133283324-133283346 GGGGGTGAACAAAGGACAAAAGG - Intronic
939644745 2:144683800-144683822 CAAGGTGAATTCAGGACAAATGG - Intergenic
940183224 2:150956991-150957013 CAGGGTGAGAACAGGAAAGAAGG - Intergenic
941366460 2:164617336-164617358 CATTGTGGACACAGGATACAAGG + Intronic
943100655 2:183482012-183482034 CAATGAGAACACAGGACGCAGGG + Intergenic
945701605 2:213177587-213177609 GAGGGTGAACAAAGAATACAAGG + Intergenic
946041991 2:216790603-216790625 CAGGTGGAGCACAGGACCCACGG - Intergenic
947428973 2:230009165-230009187 CAGGAGGAAGTCAGGACACAGGG + Intronic
948290861 2:236823409-236823431 CAGAGTAAGCACAGGACACCTGG + Intergenic
948712327 2:239832976-239832998 CAGGCCAACCACAGGACACAGGG - Intergenic
948795428 2:240399993-240400015 CAGCCTGGACACAGGACTCAGGG + Intergenic
1169142913 20:3236179-3236201 CAGGCTAAACTCAGGACACTGGG - Intronic
1169319385 20:4618715-4618737 CAGGGTAAAGCCAGGAGACAGGG + Intergenic
1169405457 20:5317660-5317682 CAGACTGAACACAGTCCACAAGG + Intergenic
1169508108 20:6234637-6234659 AATGGTGAACAGAGGAGACAAGG - Intergenic
1169596721 20:7208491-7208513 CAGAGTGAACACAAGAGACAGGG - Intergenic
1170124797 20:12950654-12950676 TAGGGTGAACACAGCAGAGATGG - Intergenic
1170760839 20:19250096-19250118 CAGCGTGGACACTGCACACATGG - Intronic
1171041756 20:21770640-21770662 CAGAGTGAACAGATGACATACGG - Intergenic
1172080588 20:32337760-32337782 CAGGGGAAATACAGGACAGACGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172706446 20:36885803-36885825 CAGGAAGAAGACAGGCCACACGG + Intronic
1172944787 20:38678789-38678811 CTGTGTGACCACAGGATACAGGG + Intergenic
1174132074 20:48352235-48352257 CAGGGTGATCACGTGACCCAGGG - Intergenic
1174585963 20:51608587-51608609 CAGAGAAAACACAGGAAACATGG + Exonic
1175400676 20:58698364-58698386 CAGGGGAGAAACAGGACACAGGG + Intronic
1175723325 20:61300624-61300646 CAGGAGGAACACTGGACAGAGGG - Intronic
1175745491 20:61454116-61454138 CAGAGTGCACACAGGTCACCAGG - Intronic
1177286972 21:19064375-19064397 GAGGGTGAACTCAGGTCAGATGG + Intergenic
1178818879 21:35957211-35957233 CAGGCTGAATACAAGACAGAAGG + Intronic
1179497269 21:41780508-41780530 CAGTGTGAGCACAGTCCACAGGG + Intergenic
1179550045 21:42138060-42138082 ATGGGTGACCACAGGACCCAGGG + Intronic
1179895244 21:44358197-44358219 CAGGGTGGCCACAGCAGACACGG - Intronic
1180239184 21:46488471-46488493 CAGGGTGTCCACAGCAGACAAGG + Intronic
1181066245 22:20307425-20307447 CCGGGTGCCCAGAGGACACAGGG + Intergenic
1181083211 22:20427401-20427423 CATGGGGTACACAGTACACAGGG + Exonic
1183086973 22:35492321-35492343 CAGGGAGCACACCAGACACAGGG - Intergenic
1183500286 22:38174815-38174837 CAACGTGAACACAGGTCACCTGG + Intronic
1183690797 22:39387347-39387369 CAGGGAGGACCCAGGACTCAGGG + Intergenic
1183951517 22:41355466-41355488 CAGGGTGCTCCGAGGACACATGG + Exonic
1184605787 22:45574112-45574134 CAAAGTGAACAAGGGACACATGG - Intronic
1184849513 22:47112286-47112308 CTGGGTGAACACTGGGCAGAAGG - Intronic
1184927252 22:47651496-47651518 CAGGGTGGTCAAAGGGCACAGGG + Intergenic
1185081210 22:48710375-48710397 CTGGGTGAACGCAGGAGGCAGGG - Intronic
950725694 3:14915481-14915503 CAGAGTGAGCCCTGGACACATGG - Intronic
950725752 3:14915835-14915857 CAGGGTGAACCCTGTACACATGG - Intronic
950725765 3:14915907-14915929 CAGGGTGAACCCTGTACACATGG - Intronic
952997960 3:38903663-38903685 GAGGGCCAACTCAGGACACATGG + Intronic
953186454 3:40642420-40642442 TAGGGTGGACACAGGACACAGGG + Intergenic
953262755 3:41356143-41356165 CAGGGAGAACACAGGGGACAGGG - Intronic
953329835 3:42043588-42043610 CATGGAGAAAACAAGACACAGGG - Intronic
953836670 3:46352108-46352130 CAGGTCTTACACAGGACACATGG + Intergenic
953904682 3:46862550-46862572 CAGGGAGCAGGCAGGACACAGGG + Intronic
954468487 3:50672763-50672785 CAGGGTGAAAATGGGAGACAGGG + Intergenic
955143256 3:56290762-56290784 CAGGTTGAACCCAGGACAGTGGG - Intronic
955393385 3:58537126-58537148 CAGTGCGGACACAGGACAGAGGG - Exonic
958072494 3:88632281-88632303 CAGGGTGACCTGAGGACACCAGG - Intergenic
961411072 3:126720787-126720809 GAGGGTGGAAACAGGACACCAGG - Intronic
961761213 3:129169325-129169347 CAGACTGAACACAGAACTCAAGG + Intergenic
962410755 3:135139999-135140021 CAGAGTGCCCACAGGACTCAGGG + Intronic
965314327 3:167172525-167172547 CAGGGTGAAGTCATGAGACAGGG - Intergenic
965377309 3:167941448-167941470 CAAGTTGAACACAGGAAACTGGG - Intergenic
965630094 3:170724291-170724313 CAAAGTGAACACAGGACATGAGG + Intronic
966325427 3:178747857-178747879 CAGGGTGAACACCTGTCATAAGG - Intronic
966819838 3:183915684-183915706 CAGGATGATCTCAGGGCACAGGG + Intergenic
967988437 3:195113554-195113576 CAGTGTGAACCCAGCACTCACGG + Intronic
968230086 3:197000420-197000442 CAGGGTGTATAGCGGACACATGG - Intronic
968666390 4:1824638-1824660 AAGTGTGAACACATGACACTCGG + Intronic
968704870 4:2073138-2073160 CCGAGTGGACACAGGAAACAAGG - Intronic
968741940 4:2335510-2335532 CAGGGGGCACTCAGGACACGTGG + Intronic
973628102 4:52792679-52792701 CAGGATGAACACTGGAAAGATGG + Intergenic
974235342 4:59173574-59173596 AAGGGGAAACACAGGTCACAGGG + Intergenic
976975350 4:91160070-91160092 CAGGGTGGAAACATCACACATGG - Intronic
977309066 4:95362294-95362316 CAGGATGAGCACATGACCCAAGG + Intronic
978203947 4:106057162-106057184 CAGAGTGAACAAAGCTCACAAGG - Intronic
978710364 4:111773052-111773074 CAGGGGGAAAACATTACACAGGG + Intergenic
984872180 4:184335563-184335585 CAGGCTGAAGACAGGATGCAAGG - Intergenic
985166355 4:187099222-187099244 AACAGTGAACACAGGACCCAAGG - Intergenic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
986368663 5:7059703-7059725 CAGGGTGAGGACAGGAAAAAAGG + Intergenic
987125916 5:14812578-14812600 CAGGCTGAAGACAGGGCTCAAGG - Intronic
988062122 5:26184934-26184956 CAATGAGAACACAGGACGCAGGG - Intergenic
988525314 5:31982195-31982217 TAGGCTGATCACAGCACACATGG - Intronic
990873031 5:60454596-60454618 CAATGAGAACACATGACACAGGG + Intronic
993353811 5:86881581-86881603 CAGGGTGACCAAAGGACATGAGG - Intergenic
993432696 5:87851230-87851252 CAGGCTGAATTCAGCACACAGGG + Intergenic
993974354 5:94458441-94458463 CAGGTTGAGAACAGGACACTAGG + Intronic
997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG + Intergenic
997786007 5:136714718-136714740 CAGGGTGAATAGAAAACACAGGG - Intergenic
999102295 5:149036656-149036678 CAGGGGGAACAGAGGACCCCAGG - Intronic
1000247105 5:159457877-159457899 CAGGGTGACCCCAGAACAAAGGG + Intergenic
1000535599 5:162474271-162474293 GAGGTTGCAAACAGGACACAAGG - Intergenic
1000859875 5:166444729-166444751 CAGTGAGAACACATGACACAGGG - Intergenic
1001957551 5:175858491-175858513 CAGCGTGAACAGATGCCACAAGG + Intronic
1003031437 6:2604545-2604567 CACAGTGCACACAGGCCACATGG - Intergenic
1004478816 6:15999695-15999717 CAGGGTGAGCTCAGGAGAAATGG - Intergenic
1006679690 6:35788061-35788083 CAGGGTGAACACAGAGCTCTGGG - Exonic
1006833171 6:36981222-36981244 CAGGCTGCTCACAGGACAAAAGG + Intronic
1008396750 6:51017494-51017516 CAGGTAGATCACAGGAAACATGG + Intergenic
1009566410 6:65316673-65316695 CAATGAGAACACATGACACAAGG - Intronic
1010774969 6:79875028-79875050 CAGGTTGAACACAGAAGATACGG - Intergenic
1011067970 6:83349556-83349578 AGGGATGAAGACAGGACACATGG - Intronic
1012289312 6:97433092-97433114 CATGGTAAACAAAGGACAAATGG + Intergenic
1013729643 6:113149372-113149394 CAGGGAGCACACATGCCACATGG - Intergenic
1015121100 6:129702501-129702523 AAGGGTGGGCACAGGACAGAGGG + Intronic
1015588382 6:134799499-134799521 AAGGGTGAACACAGGGTCCAGGG + Intergenic
1016343750 6:143088759-143088781 CAAAGTGAATACAGGAAACATGG + Intronic
1016981780 6:149861227-149861249 CAGGGGACACACAGGACACTGGG + Intronic
1017744045 6:157431070-157431092 CAGAGTGTATACGGGACACAAGG + Intronic
1018517040 6:164594624-164594646 CAGGCTGCCCACAGGACACAAGG + Intergenic
1019162742 6:170080159-170080181 GAGGAGGAACACAGGACACTTGG - Intergenic
1019290061 7:245964-245986 CAGGGTGCACACAGCAAACCGGG + Intronic
1020403342 7:7803102-7803124 AATGGTGAAAATAGGACACAAGG + Intronic
1022329236 7:29361950-29361972 CATGGGGAACACTGGAGACAAGG - Intronic
1024094753 7:45974718-45974740 CAGGGTCAACTCAGGCAACAGGG - Intergenic
1025005997 7:55355338-55355360 CAGGGTGATCAGAGGTCACCGGG + Intergenic
1026467702 7:70668738-70668760 CTGGGTGAACGCATGACATAAGG + Intronic
1028666388 7:93348386-93348408 CAGGTTGAAAAAAGAACACAAGG - Intronic
1032196746 7:129793876-129793898 CAGGGTGCCTGCAGGACACAGGG - Intergenic
1032419516 7:131766498-131766520 CAGCGTGAACCCAGGACAGAGGG + Intergenic
1032795320 7:135271599-135271621 CAGGCTGGACACAGGAGACCTGG - Intergenic
1035675452 8:1452581-1452603 AAGGGTGGAGGCAGGACACAGGG + Intergenic
1036100764 8:5781827-5781849 CAGTAAGAACACAGGATACAAGG - Intergenic
1036586770 8:10131715-10131737 CAGGGTGGACACTGGCCATAGGG - Intronic
1037301478 8:17456148-17456170 CTGGAAGAACACAGGACCCAAGG - Intergenic
1038749137 8:30280037-30280059 CAGGGTGGACACCACACACAAGG - Intergenic
1039007424 8:33055499-33055521 CAATGAGAACACATGACACAGGG + Intergenic
1039425213 8:37479684-37479706 CAGGGGGAGCACAGGACAGGTGG + Intergenic
1039438957 8:37581431-37581453 CCAGGGGAGCACAGGACACATGG - Intergenic
1040386017 8:46915623-46915645 CAGGGTGCATGCAAGACACAAGG + Intergenic
1044622536 8:94204341-94204363 CAATGAGAACACATGACACAGGG - Intronic
1045404074 8:101847741-101847763 CTGGGTGAACATGGGACCCAAGG + Intronic
1045954150 8:107887554-107887576 CAGGGTATACAGGGGACACAGGG - Intergenic
1047706326 8:127503327-127503349 CAATGAGAACACTGGACACAGGG + Intergenic
1047806555 8:128367036-128367058 CAGGATGAACCCAAGGCACATGG - Intergenic
1048306464 8:133288241-133288263 CAGGGTGAGCTCAGGACAGCTGG - Intronic
1049932347 9:469649-469671 CATGCTGCACACAGGAGACAGGG - Intergenic
1053196783 9:36125954-36125976 CAGGGTGCTCACAGGACAGAGGG - Intergenic
1053201049 9:36151760-36151782 CAGGGGGAGCCCAGGGCACAGGG - Intronic
1053294948 9:36906074-36906096 CAGGGGAACTACAGGACACACGG + Intronic
1053442966 9:38130907-38130929 CAGGCAGATCACAGGACAAAGGG - Intergenic
1056378178 9:86034551-86034573 CTGGGTGAGCACGGAACACAAGG + Intronic
1057561474 9:96131256-96131278 CAGGTTGAAGGCAGGACTCAAGG + Intergenic
1057794064 9:98143205-98143227 GAGGGGGAAGACAGGACAGAAGG + Intronic
1060168247 9:121438891-121438913 CAGGGTGAAGGCTGGACACTGGG - Intergenic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1062020355 9:134316402-134316424 CAGGGAGGGGACAGGACACAAGG - Intergenic
1187386782 X:18856427-18856449 AAGAGGGACCACAGGACACAGGG - Intergenic
1188336776 X:28945547-28945569 CAATGAGAACACATGACACAGGG + Intronic
1188539620 X:31234983-31235005 CAGGGTGATCAGACGTCACATGG + Intronic
1191777673 X:64834266-64834288 CAATGAGAACACAGTACACAAGG - Intergenic
1194764985 X:97839216-97839238 GAGGGGGAACACTGGCCACAGGG + Intergenic
1196887326 X:120260669-120260691 CAGGCTGAACGCAGCACAGAAGG - Exonic
1198659741 X:138955311-138955333 CGGAGGGAACACAGGAAACATGG - Intronic
1199027153 X:142953447-142953469 AAATGAGAACACAGGACACAGGG - Intergenic
1199596223 X:149508183-149508205 CAGAATGATGACAGGACACAGGG + Intronic
1199722698 X:150553575-150553597 TAGGGTGACCACAGAACACATGG - Intergenic
1200470487 Y:3580003-3580025 CAGGTTTACCACAGTACACAAGG - Exonic
1200743723 Y:6883391-6883413 CAATGAAAACACAGGACACAGGG + Intergenic
1201455880 Y:14166354-14166376 CAGTGGGAACATAGAACACAGGG + Intergenic