ID: 903769208

View in Genome Browser
Species Human (GRCh38)
Location 1:25753525-25753547
Sequence GCCGGCGTTCAACACCCCCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903769202_903769208 13 Left 903769202 1:25753489-25753511 CCGAATAAAGGCCATCAGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 903769208 1:25753525-25753547 GCCGGCGTTCAACACCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 33
903769198_903769208 30 Left 903769198 1:25753472-25753494 CCTCCTTTACAGGTGTTCCGAAT 0: 1
1: 0
2: 0
3: 9
4: 105
Right 903769208 1:25753525-25753547 GCCGGCGTTCAACACCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 33
903769205_903769208 2 Left 903769205 1:25753500-25753522 CCATCAGGCTGGGAGAGAAGCTC 0: 1
1: 0
2: 1
3: 22
4: 256
Right 903769208 1:25753525-25753547 GCCGGCGTTCAACACCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 33
903769199_903769208 27 Left 903769199 1:25753475-25753497 CCTTTACAGGTGTTCCGAATAAA 0: 1
1: 0
2: 1
3: 5
4: 75
Right 903769208 1:25753525-25753547 GCCGGCGTTCAACACCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903769208 Original CRISPR GCCGGCGTTCAACACCCCCA CGG Exonic