ID: 903773360

View in Genome Browser
Species Human (GRCh38)
Location 1:25777967-25777989
Sequence CCTCCTTTGCCTGGGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 374}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903773346_903773360 24 Left 903773346 1:25777920-25777942 CCCCTCCTGTGCCCTGGCAGGCA 0: 1
1: 1
2: 3
3: 44
4: 406
Right 903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 374
903773351_903773360 12 Left 903773351 1:25777932-25777954 CCTGGCAGGCATCTTGACCAGCA 0: 1
1: 0
2: 0
3: 14
4: 191
Right 903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 374
903773348_903773360 22 Left 903773348 1:25777922-25777944 CCTCCTGTGCCCTGGCAGGCATC 0: 1
1: 2
2: 3
3: 36
4: 296
Right 903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 374
903773350_903773360 13 Left 903773350 1:25777931-25777953 CCCTGGCAGGCATCTTGACCAGC 0: 1
1: 0
2: 0
3: 9
4: 160
Right 903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 374
903773354_903773360 -5 Left 903773354 1:25777949-25777971 CCAGCAGAGATCAATGGGCCTCC 0: 1
1: 0
2: 1
3: 4
4: 120
Right 903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 374
903773349_903773360 19 Left 903773349 1:25777925-25777947 CCTGTGCCCTGGCAGGCATCTTG 0: 1
1: 0
2: 1
3: 32
4: 238
Right 903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 374
903773347_903773360 23 Left 903773347 1:25777921-25777943 CCCTCCTGTGCCCTGGCAGGCAT 0: 1
1: 0
2: 4
3: 30
4: 364
Right 903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG 0: 1
1: 0
2: 3
3: 44
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903773360 Original CRISPR CCTCCTTTGCCTGGGATGGA GGG Intronic
900125592 1:1067715-1067737 CCTCCTTGGCCTGGTCGGGAAGG - Intergenic
900495359 1:2973694-2973716 CCCTCTGTGCCTGGGAAGGATGG - Intergenic
900495520 1:2974318-2974340 CCTCCTGTGCCATGGGTGGAGGG - Intergenic
900661835 1:3788544-3788566 CCTGCTTCGCCTGGAATGGATGG + Intronic
900793536 1:4694206-4694228 GCTCCTTTGCCGGGGGGGGATGG + Intronic
900935487 1:5763937-5763959 TAGTCTTTGCCTGGGATGGAGGG - Intergenic
901120891 1:6892688-6892710 CCTCTTTTGCCTCGGTTGGTTGG + Intronic
901324336 1:8357922-8357944 GGCCCTGTGCCTGGGATGGAGGG - Intronic
901506340 1:9688151-9688173 GCTCATCTGCCTGGGATGGGCGG + Intronic
902323979 1:15686512-15686534 GCTCTGTTGCCTGGGCTGGAGGG + Intronic
902796519 1:18804069-18804091 CTTCCCTTCCCTGGGACGGATGG + Intergenic
903509673 1:23865842-23865864 CCTCCTTTGCTGGGGACTGAGGG - Intronic
903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG + Intronic
904046431 1:27611946-27611968 CCTCCTTTGCCAGGGCAGGGAGG - Intergenic
905510129 1:38512874-38512896 GCTCCTTTCCCTGGGGTGGCAGG - Intergenic
905975159 1:42168953-42168975 CCTCCCTTGCCTGGCATTCAGGG + Intergenic
906336106 1:44932639-44932661 CCTCTTTTTCTTGGGATGGGAGG - Intronic
907255329 1:53174415-53174437 TCTCCTTGGCCAGGGATGGAAGG - Intergenic
907286878 1:53386290-53386312 CCTCCTTTGACTTGGCTGGAAGG + Intergenic
907678823 1:56544414-56544436 TCAGCTTTACCTGGGATGGAAGG - Intronic
908423435 1:63981640-63981662 GATCCTTTGGCTGGGCTGGAAGG + Intronic
908802211 1:67891903-67891925 CCTCCATTGCTTGGGACTGAGGG + Intergenic
908953257 1:69588131-69588153 CTAACTTTCCCTGGGATGGAAGG - Intronic
911182928 1:94877057-94877079 CCTGGTTTGCCTGGGAGTGAGGG - Intronic
911571787 1:99526271-99526293 CCTCCTTTACATTGGAAGGAAGG + Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913194769 1:116446562-116446584 ACTCCTTTACCTGGCATAGAAGG + Intergenic
914819979 1:151094133-151094155 CCTCCATTTCCTGGGTTTGAGGG + Intronic
915312051 1:155009796-155009818 CCTCATATGCCTGGGAAGAAGGG + Intronic
915519173 1:156431237-156431259 CCTCCTTTCCCTGGAATTGAGGG - Intergenic
915533700 1:156520407-156520429 ACTCTGTTGCCTGGGCTGGAGGG - Intergenic
915681039 1:157582238-157582260 CCTCCTTTTCCGTGGATGAAAGG - Intronic
915682668 1:157596467-157596489 CCCCGCTTCCCTGGGATGGATGG - Intronic
916061150 1:161099267-161099289 CCGCCCTTGCCAAGGATGGATGG - Intronic
916319475 1:163487514-163487536 ACTCCTTAGCCTGGCATGGGAGG - Intergenic
916645908 1:166784955-166784977 CCTCCTGTGCCTGGCTTGGTGGG - Intergenic
918554648 1:185784142-185784164 CATCCTGTGCCTGGCTTGGAGGG - Intronic
920301580 1:204992264-204992286 CCTCCACTGCCTGGCATGTAAGG - Intronic
920309391 1:205039935-205039957 GCTCCTCTGCCTGGAATGTAGGG - Intergenic
920693336 1:208163495-208163517 TCACCTTTGCCTGGGATGGCTGG + Intronic
920854476 1:209651832-209651854 ACTCTTTTGGCTGGGGTGGAGGG + Intronic
923479128 1:234366185-234366207 CTTGCTTTGCCTGGAAGGGAAGG + Intergenic
1063464262 10:6232771-6232793 TGTTCTTTGTCTGGGATGGAGGG + Intronic
1064332686 10:14408552-14408574 CTTCCTCTGCCTGGGATAAATGG - Intronic
1064987687 10:21227207-21227229 CTTCCTTTGCCCAGGATAGAGGG + Intergenic
1065151999 10:22831538-22831560 CCTCCTTGTGCTGGGATGCATGG - Intergenic
1067231129 10:44411515-44411537 CCTCCTGTGCCTGGCTTGGTGGG - Intergenic
1067570340 10:47366914-47366936 CCTCCTGTGGAGGGGATGGATGG + Exonic
1067685037 10:48461613-48461635 CCTTCTTTGCCTGGGCTGCCAGG - Intronic
1067911403 10:50350518-50350540 CCTCCTGGGCCTGTGATGGGAGG - Intronic
1067931500 10:50566978-50567000 ACTCTGTTGCCTGGGCTGGAGGG + Intronic
1070727835 10:78804077-78804099 CCTAGTTTGCCTGGGACTGAGGG + Intergenic
1071021058 10:81057191-81057213 CCTCCTTTGCCTAGGATGAAGGG + Intergenic
1071355456 10:84789265-84789287 CCAGCTTTGCCTTGGATGGCAGG + Intergenic
1072460387 10:95612954-95612976 CATCCTTTGACTGGAAAGGAAGG - Intronic
1073355324 10:102849253-102849275 CCACCTCTGCCTGGGATTGCAGG + Intergenic
1074080659 10:110165876-110165898 CCTGATTTGCCCGGGATGGAAGG - Intergenic
1074875937 10:117613468-117613490 CCTTCTCTGCCAGGGATGGATGG - Intergenic
1075464030 10:122638064-122638086 CCTCATTTGCCTGGGAGTGAGGG - Intronic
1075467140 10:122660259-122660281 CCTTCTTTCCTTGGGATGCAGGG + Intergenic
1075540342 10:123307503-123307525 CCTCCTGCTCTTGGGATGGAAGG + Intergenic
1075863741 10:125699170-125699192 CTTACCTTCCCTGGGATGGAAGG - Intergenic
1076717863 10:132375658-132375680 CCACCTTTGGCTAGGAGGGAGGG + Exonic
1076868788 10:133182622-133182644 CCTCCCTTGCCTGAGAGGGTGGG - Intronic
1077422391 11:2459072-2459094 GCCCCTGTGCCTGGGAAGGAAGG - Intronic
1077516820 11:3007120-3007142 CCTCCAGTGCTTGGGAGGGAGGG + Intronic
1077577035 11:3391760-3391782 CCTCTTTTGCCTGGAAAAGAGGG + Intergenic
1078462337 11:11523743-11523765 CCTCCTTTCCCAGGGAGGCAGGG - Intronic
1078970490 11:16405105-16405127 CGACCTTTGCCTGGGATAAAAGG - Intronic
1079312738 11:19380825-19380847 CCTGCTTTGCCTGGGATTTAGGG + Intronic
1079654957 11:22975764-22975786 CCTCCTAGGCCTGTGATGGGAGG - Intergenic
1081265393 11:41014748-41014770 TCTGGTTTGCCTGGGATGGAGGG + Intronic
1081612030 11:44568561-44568583 CCTCCCTGGGCTGGGATGGGAGG - Intronic
1081993791 11:47351152-47351174 CCTCCTGTTCCCTGGATGGATGG + Intronic
1082249575 11:49963663-49963685 CCTCCAGTGCCTGGGTTGGTGGG + Intergenic
1083113374 11:60434448-60434470 CCTGCTTTGCCTTAGATGGTGGG - Intronic
1084166537 11:67377438-67377460 CCTCCTCTCCATGGGATGGTGGG + Intronic
1084267096 11:68010660-68010682 CCTCCTTTTCCTGGGATTCCCGG + Intronic
1084461204 11:69297658-69297680 CCTCCCTTGCTTGGAATGAATGG - Intronic
1084846301 11:71903152-71903174 CCTCTTTTGCCTGGAAAAGAGGG - Intronic
1085000289 11:73027706-73027728 CCTCCTGGGCCTGTGATGGCGGG - Intronic
1085647966 11:78240236-78240258 CATCCTTTCCCTGGAATGCAGGG - Intronic
1086456875 11:86967888-86967910 CCTCCTGTGCCTGGCTTGGTGGG - Intergenic
1086604954 11:88685587-88685609 CCTCCTGGGCCTGTGATGGGAGG - Intronic
1088004758 11:104926987-104927009 CCTCCCTTGGCTGGGATGTGGGG - Intergenic
1088186339 11:107175884-107175906 CCTCCTGCGTCTAGGATGGATGG - Intergenic
1088702119 11:112422669-112422691 CATCCCTGGCCTGGGATGGTTGG + Intergenic
1092169147 12:6362498-6362520 CCTCCCCTGCCTAGGGTGGAAGG + Intronic
1092433643 12:8428625-8428647 CCTCTTTTGCCTGGAAAAGAGGG + Intergenic
1092784029 12:12011713-12011735 CCTGCTTTACCTGGGACCGAAGG + Intergenic
1093677628 12:21962524-21962546 CCTCCTATGCCTGGCTTGGTGGG + Intergenic
1094368081 12:29705464-29705486 CCTCCTTTTCCTGGTATAGATGG - Intronic
1094579273 12:31718987-31719009 CCTCCTGTGCCTGGCTTGGCAGG - Intronic
1094819697 12:34214935-34214957 TCTCAATTGCCTGGGATCGAGGG - Intergenic
1095944816 12:47747902-47747924 CCTCCTTTGCCTCAGGTGGGTGG - Intronic
1096846729 12:54411632-54411654 CCTCCTTGGGCTGGGCTGGATGG + Intronic
1098466335 12:70790756-70790778 CCTCCGCTTCCTGGGATGGCTGG - Intronic
1101163630 12:102005749-102005771 GCTCCTTTGGTTGGCATGGAGGG - Intronic
1101490364 12:105204345-105204367 CCTCCCTTTCCTGGCATGGCGGG + Intronic
1102381254 12:112468636-112468658 CCACCTGAGCCTGGGATGCAGGG + Intronic
1103941961 12:124506085-124506107 CCTGCTTTGCCTGGGGTGAAGGG - Intronic
1104461143 12:128957155-128957177 ACTCCCTTGCCTGTGCTGGAAGG + Intronic
1104768327 12:131345056-131345078 CCTCCTGTGCCTGGGCTGAGAGG - Intergenic
1104835570 12:131787699-131787721 CCTCCTGCTCCTGGGACGGATGG + Intronic
1104965996 12:132509086-132509108 CCTCCTGGGCCCGGGCTGGACGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105281455 13:18965045-18965067 CCTCCTGTCCCAAGGATGGATGG + Intergenic
1105290657 13:19051018-19051040 CCTTCTGTTCCAGGGATGGATGG + Intergenic
1106033063 13:26019754-26019776 CCTCCTTAGCCTTGGATAGGTGG - Intronic
1106231700 13:27825831-27825853 CATCCTATGCCTGGGCTGGCGGG + Intergenic
1106244254 13:27933755-27933777 CCTCCTGTGGCTGGGATTGCAGG + Intergenic
1106774266 13:32993502-32993524 GCTCTGTCGCCTGGGATGGAGGG + Intergenic
1106784361 13:33092287-33092309 CCTCCTTCTCCTGGGAGGGTGGG - Intergenic
1107158643 13:37198789-37198811 CCTCCTTGGCCTGGGTTACAAGG + Intergenic
1107664970 13:42679304-42679326 GCTCCATTCCCTGAGATGGAAGG + Intergenic
1107726451 13:43304462-43304484 ACTCCTTTCTCTGGGATGGGCGG - Intronic
1110544358 13:76739465-76739487 TCCCCTTTGCCTGTGATGCATGG - Intergenic
1110843287 13:80166964-80166986 CTTCCTTTGCCTTGGATCCAGGG - Intergenic
1114565783 14:23631852-23631874 CCTCTTTTGCCTGGGAGGATGGG - Intronic
1114653066 14:24299103-24299125 CCTCCTTTGCCTGTGAGTCATGG - Exonic
1115681962 14:35750507-35750529 CCTCATATTCCTGGGATGGAAGG - Exonic
1116127094 14:40801270-40801292 CCTCCTGGGCCTGTGATGGGAGG + Intergenic
1117060219 14:51954713-51954735 CTTCCTTTTCCTGGGAAGAAGGG + Intronic
1117123693 14:52596619-52596641 CCTCCTGTGCCTGGCTTGGTGGG - Intronic
1118010364 14:61604581-61604603 GCTCCTTGGCCTGGGAGGCAGGG + Intronic
1118143699 14:63113206-63113228 TTTGCTTTGCCTGGGATGCAAGG - Intergenic
1120900650 14:89572866-89572888 ACTCATTTGCATGGCATGGAAGG - Intronic
1120991467 14:90381214-90381236 CCTGGTTTGCCTGGGACAGAGGG + Intergenic
1121440250 14:93944462-93944484 CCTTCCATGCCTGGGACGGATGG + Intronic
1121921214 14:97883424-97883446 CCTCCCTTGATTTGGATGGAAGG - Intergenic
1121959716 14:98248009-98248031 GCTCCTTTGCCCAGGCTGGAGGG + Intergenic
1122999178 14:105283134-105283156 CCTCCTCTGCCTTGGCTGGCTGG - Intronic
1123139189 14:106058772-106058794 CCTCCTTTATCTGGGCTGGATGG - Intergenic
1123207196 14:106725046-106725068 CCTCCTTTATCTGGGCTGTATGG - Intergenic
1123212220 14:106772049-106772071 CCTCCTTTATCTGGGCTGTATGG - Intergenic
1123722185 15:23069361-23069383 GCTCCTTTGCCCAGGTTGGAGGG + Intergenic
1126476319 15:49068873-49068895 CCTCCTGTGCCTGGCATGGCAGG + Intergenic
1126742068 15:51787174-51787196 CCTCCTGTGCCTGGCTTGGCAGG + Intronic
1127023971 15:54782048-54782070 CCTCCGTTGCCGAGGCTGGACGG - Intergenic
1127487967 15:59437233-59437255 GCTCCTTCCCCTGGGTTGGAAGG + Intronic
1128257392 15:66208049-66208071 ACTCTGTTGCCTGGGCTGGAGGG - Intronic
1129607399 15:77031550-77031572 CCCCCTCTGCCGGGGATGGGAGG + Intronic
1130108695 15:80948006-80948028 CCTCCTTTGGCTGGTTTGAAGGG - Intronic
1130227851 15:82073335-82073357 CCTGCTATGCCTGGGAGGGCGGG + Intergenic
1130911204 15:88271991-88272013 CCCCCTTTGCCCTGGGTGGAGGG - Intergenic
1131992176 15:98103184-98103206 CCTGGTTTGCCTGGGATGGAGGG - Intergenic
1132143345 15:99412423-99412445 CCTCCTTATGCTGGGCTGGAGGG - Intergenic
1132481516 16:168599-168621 GCTCTTATGCCTGGGATGCAGGG - Intergenic
1132594823 16:743945-743967 CCCCCTTTCCCTGGGCTGGAAGG + Intronic
1132653641 16:1032480-1032502 GCTCCTTTCCCTGGGATGTGGGG - Intergenic
1133133776 16:3694923-3694945 CCTCCTGAGGCTGGGAGGGAGGG + Intronic
1133185536 16:4094744-4094766 CCTCCTTTGCCTGGGTGAGGCGG - Intronic
1134069917 16:11254739-11254761 CCTCCCCGGCCTGGGTTGGAGGG - Exonic
1134658223 16:15963769-15963791 CCTCCTAGGCCTGTGATGGGAGG + Intronic
1135949097 16:26896172-26896194 CCTCCCTTGACTGGGATTGGGGG + Intergenic
1136579361 16:31142498-31142520 CCTCCTTTTCCTGGTAGGCAGGG + Exonic
1137413078 16:48245600-48245622 CCTGGTTTCCCTGGGACGGAGGG - Intronic
1137504074 16:49035792-49035814 CCTCCCAAGCCTGGGATGCATGG + Intergenic
1140234238 16:73144259-73144281 AATCCTTTCCCTGGGATAGACGG - Intronic
1140982841 16:80127197-80127219 TCTCATTTGCCTGGGATGGAAGG - Intergenic
1141567374 16:84911856-84911878 CCTCCCTTCCCTGGGGTAGAAGG - Intronic
1142679958 17:1541452-1541474 CCTCTTTTGCCTGGCCGGGAAGG - Intronic
1143469849 17:7165914-7165936 CCACCTTTGCCTGTGATGTTAGG + Intergenic
1143616386 17:8052642-8052664 CCTCCTTGGGCTATGATGGATGG + Intergenic
1144482370 17:15638684-15638706 CCTTCCTTGCCAGGGATGGGAGG - Intronic
1144636971 17:16916259-16916281 CCTCTTTTGCCAGGAGTGGAAGG + Intergenic
1144648205 17:16989739-16989761 CCTCCTGTGCCAGGAGTGGAAGG - Intergenic
1144916313 17:18726348-18726370 CCTTCCTTGCCAGGGATGGGAGG + Intronic
1145268952 17:21393974-21393996 CCTCCTTTGCCTGGGTCCTATGG - Intronic
1147241192 17:39091491-39091513 CCTGATCTGCCTGGGATGGAAGG - Intronic
1147303446 17:39547717-39547739 CCTCCTATGCCCAGGATGCAGGG - Intronic
1147526161 17:41225943-41225965 CCTGATTTGCCTGGGACTGAAGG - Intronic
1149310372 17:55387138-55387160 CATCCTTTGCCTGGGAGGATAGG + Intergenic
1149561877 17:57613341-57613363 CCTGGTTTGCCTGGGACTGAGGG + Intronic
1149745497 17:59093683-59093705 CCTGTTTTGACTGGGAGGGAGGG - Intronic
1151094747 17:71483950-71483972 CCTCCTTTTGCTGGAATGTAAGG + Intergenic
1151578599 17:74964920-74964942 CCTGCTTTGCCAGGGGAGGATGG - Intronic
1151905131 17:77042992-77043014 CCTCCTATGCCTGGTAGTGATGG + Intergenic
1152727823 17:81956360-81956382 CCCACTTTGCCTGGGACTGAGGG + Intronic
1152821896 17:82441629-82441651 CCTCCTGTGCCTGGGAGTGGGGG - Intronic
1152888623 17:82867166-82867188 CCTCCGTGGCCTGGGGTGGGGGG + Intronic
1158092234 18:53727693-53727715 CCTCCTAAGCCTGTGATGGGAGG + Intergenic
1158857275 18:61555199-61555221 CCTACTTGTTCTGGGATGGATGG + Exonic
1160282435 18:77504238-77504260 GCTCTTTTGCCTTGGTTGGAGGG + Intergenic
1160744429 19:704052-704074 CCGACATTGCCTGGGATGCAGGG + Intergenic
1160881462 19:1322548-1322570 CCTCCTTTGCCTCCTCTGGAGGG - Intergenic
1161010671 19:1958153-1958175 CCTGCTCTGCCTGGAATTGAGGG + Intronic
1161284804 19:3463629-3463651 CCTCCTATGCCGGGGGTGGGGGG - Intronic
1163346421 19:16745385-16745407 CCCAGTTTGCCTGGGACGGAGGG + Intronic
1164160771 19:22624131-22624153 ACTCCTGGGCCTGGGAGGGAGGG + Intergenic
1164932451 19:32186197-32186219 CCTCTTCTCCGTGGGATGGAGGG - Intergenic
1165136688 19:33674138-33674160 TCTCCTTGCACTGGGATGGAGGG + Intronic
1165387520 19:35519542-35519564 GCTGCTTTGCCTGAGATGGGTGG - Intergenic
1166247203 19:41537684-41537706 CCTCCACTGCCTGGGATGAGGGG + Intergenic
1167286761 19:48602618-48602640 CCTTCCTTGCCTGGGACGGAGGG + Intronic
925840362 2:7986226-7986248 CCTCATTAGCCTGGGGTGGTTGG - Intergenic
926107587 2:10162092-10162114 CCGCCGCTGCCTGGGATGAATGG + Intronic
926228239 2:10983537-10983559 CCTCCGAAGCCTGGGGTGGAGGG - Intergenic
926267801 2:11342940-11342962 CCTCCCTTTCCAGGGACGGACGG - Intronic
928627758 2:33158378-33158400 CCTTCTGTGTCTGGGATGGGAGG - Intronic
930238245 2:48908611-48908633 CCTGCCTTGGCTGGGAGGGAAGG - Intergenic
934045933 2:88172433-88172455 CTTAGTTTGCCTGGGATTGAGGG + Exonic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934795028 2:97092937-97092959 GCTCTGTTGCCTGGGCTGGAGGG - Intronic
935204603 2:100887073-100887095 CCTCGTTGGCCTGGGCTGCAAGG + Intronic
935346436 2:102112496-102112518 CCTCCTTTCCCTGGACTGGGAGG - Intronic
936396667 2:112137088-112137110 CCTCCTTTGCATGGGAAGGTTGG + Intergenic
936709901 2:115120281-115120303 CCTCCTCATCCTGGGAAGGATGG + Intronic
937267010 2:120623103-120623125 CCTCCTTTCCCTGGGAAGAGGGG + Intergenic
938107825 2:128545282-128545304 CCTCCCTCCCCTGGGCTGGATGG - Intergenic
938109723 2:128555728-128555750 CCTCCTTGGGCTGGGCTGGAGGG - Intergenic
938685511 2:133734039-133734061 CCCCATTTGCCTGGGAATGAGGG + Intergenic
938760689 2:134423155-134423177 GCTCCTGTGCCTGGGATCCATGG - Intronic
939109639 2:137992021-137992043 CCTCCCTTGGCTGGGGGGGAGGG - Intronic
939190422 2:138911323-138911345 CCTCCTAAGCCTGGCATGGAAGG - Intergenic
939400657 2:141688826-141688848 CTTTCTTTACCTAGGATGGATGG + Intronic
941349508 2:164414537-164414559 CCTCCTAGGCCTGTGATGGAAGG + Intergenic
942135453 2:172920566-172920588 CATCCATTGCCTGCCATGGAAGG + Intronic
942569647 2:177301177-177301199 ACTCTGTTGCCTGGGCTGGAGGG + Intronic
944667931 2:201972326-201972348 CCTCCTGTCCCTGGGAGGCAGGG + Intergenic
944939710 2:204610387-204610409 CCTCTGTTGCCTAGGCTGGAGGG + Intronic
945034665 2:205694395-205694417 TCTCCTATACCTGGGAGGGAAGG - Intronic
945316115 2:208372340-208372362 CCTCATCATCCTGGGATGGATGG + Intronic
945484723 2:210381893-210381915 CCTCCTAGGCCTGTGATGGGAGG - Intergenic
946203853 2:218089425-218089447 CCTCCCTTCCCTGGGGTGGGTGG - Intronic
946901175 2:224373269-224373291 CCTTCTTTCTCTGGGAGGGAAGG + Intergenic
948579263 2:238972972-238972994 CCTGGTTTGCCTGGGACTGAGGG - Intergenic
1169636408 20:7696940-7696962 CCTGGTTTGCCTGGGACTGAGGG - Intergenic
1172232380 20:33345654-33345676 CTTACCTTGCCTGGGGTGGATGG - Intergenic
1173159935 20:40644917-40644939 GCTTCTTTGCCCAGGATGGATGG + Intergenic
1173750240 20:45470376-45470398 GCTCCTGTGCCTGGGAGGGGAGG - Exonic
1173967580 20:47124716-47124738 CCTGATTTGCCTGGGATTGAGGG - Intronic
1174302138 20:49590057-49590079 CCTCCTTTGGCTGGGGTGGTCGG - Intergenic
1174580004 20:51564557-51564579 CCTGGTTTGCCTGGGATTGAGGG + Intergenic
1174953403 20:55067531-55067553 CCTCCTTTGGCTGGGAGTGGGGG + Intergenic
1175167452 20:57054801-57054823 CCTCGTTTGCCTGGGACTGAGGG + Intergenic
1175375436 20:58520589-58520611 CCTTCTTTGCCTGGGAGGTTTGG + Intergenic
1178359565 21:31936948-31936970 CCCTCTTTGCCTGGGAAGAATGG - Intronic
1178641412 21:34347312-34347334 CCTGCTTTGCCTGGGACTAATGG + Intergenic
1179025259 21:37674305-37674327 CCTCATTTGCTTGGGACTGAGGG - Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1180950086 22:19717024-19717046 CCCCCTTTCCCTGGGATGAAAGG + Intronic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
1182014989 22:27032163-27032185 CCTCCTTCACCTGGCAGGGAAGG - Intergenic
1182018126 22:27058157-27058179 CCTCCTTTGCTTGCCATGCAAGG - Intergenic
1182754026 22:32664319-32664341 TCTCCCTGGCCTTGGATGGAAGG - Intronic
1182772461 22:32805147-32805169 CCGCCTTTGCATGGGAGGAATGG + Intronic
1183574275 22:38677212-38677234 GCTCCTTTGCCCAGGCTGGAGGG - Intergenic
1183588372 22:38766286-38766308 CCTGCTGTGCCTGGGTCGGAAGG - Intronic
1184602757 22:45553181-45553203 CCTCCTTCTCCTGGGAGGCACGG - Intronic
1184917938 22:47585983-47586005 CCTCCTTCCCCTGGGAGTGAAGG + Intergenic
1185066638 22:48635572-48635594 CCCCCCTTAGCTGGGATGGAGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949307285 3:2656831-2656853 CTTCCTTTTCCTGTGGTGGAAGG + Intronic
949397902 3:3634717-3634739 CCTCCTGTGGCTGGGGTGCAAGG - Intergenic
950423307 3:12911141-12911163 CCTCTGTTGCCTGGGTTGTAAGG - Intronic
950488002 3:13284195-13284217 CCTCCTCTCCTGGGGATGGAGGG - Intergenic
950531820 3:13556650-13556672 CTTCCTGTGCATGGGATGGGAGG + Intronic
950651692 3:14411189-14411211 CCTCCTTAGCCTGGCATTGGAGG + Intronic
952813994 3:37431177-37431199 CCTCCTGTGCCTGGCTTGGTGGG - Intronic
952943603 3:38460997-38461019 CCTCCTTCTCCTCAGATGGACGG - Intronic
953042485 3:39267574-39267596 CCTGATTTGCCTGGGACTGAGGG - Intronic
953541335 3:43821213-43821235 CCTTCATTCCCTGAGATGGATGG + Intergenic
956340111 3:68212907-68212929 CCTCCTTTGGCTGGGACCGTGGG - Intronic
957045564 3:75371374-75371396 CCTCTTTTGCCTGGAAAAGAGGG + Intergenic
957998887 3:87727036-87727058 CTTCCTGTGCTTGTGATGGAAGG - Intergenic
958254817 3:91313446-91313468 CCACCTTTGCCTGGGTTGTTTGG - Intergenic
959592746 3:108097787-108097809 CGTCCTCTGCCAGAGATGGAGGG + Intergenic
961213691 3:125143804-125143826 CCTCCCTGGCCTGGGAGGGAAGG + Intronic
961276820 3:125734254-125734276 CCTCTTTTGCCTGGAAAAGATGG - Intergenic
961671772 3:128537440-128537462 TCTCCTTCCCCTGGGCTGGAGGG - Intergenic
961877606 3:130035502-130035524 CCTCTTTTGCCTGGAAAAGAGGG + Intergenic
962134071 3:132714693-132714715 GCTCTGTTGCCTGGGCTGGAGGG - Intronic
963787688 3:149551625-149551647 CCTGGTTTGCCTGGGACTGAGGG + Intronic
965518231 3:169645347-169645369 CTTCCTTTGCATGGGAAGGTTGG + Intronic
968124939 3:196152063-196152085 CCTCCTTTGGCTGGGATTACAGG + Intergenic
968284319 3:197499206-197499228 CCACCTGTGACTGGGATGAAGGG - Intergenic
968792042 4:2671959-2671981 CCTCGTTTTCCTTGCATGGAAGG + Intronic
969215955 4:5722649-5722671 ACTCCTTTGCTTTGGAGGGAGGG + Intronic
969651241 4:8469548-8469570 TCAGCTGTGCCTGGGATGGACGG + Intronic
969787296 4:9468990-9469012 CCTCTTTTGCCTGGAAAAGAGGG - Intergenic
970136647 4:12932485-12932507 CCTCTGTGGCCTGGGAAGGATGG + Intergenic
970366687 4:15366291-15366313 CCTAATTTTCCTGGGATTGAGGG - Intronic
970926177 4:21455011-21455033 CCTTGTTTGCCTGGGACTGAGGG - Intronic
972749320 4:41973018-41973040 CCTCCTAGGCCTGTGATGGGAGG - Intergenic
973808352 4:54546839-54546861 CCTCCATTGGCTGGCAGGGAGGG - Intergenic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
975637814 4:76467807-76467829 CCTCAGTTGCCTGGGCTTGAGGG + Intronic
975998133 4:80340213-80340235 CTTCCTTTGGCTGGGAATGAGGG - Intronic
976075759 4:81297836-81297858 CCTCCTGGGCCTGTGATGGGAGG - Intergenic
976915569 4:90370180-90370202 GCTGCTTTGCCTGGCAAGGAGGG + Intronic
977654513 4:99505476-99505498 CCTCGTTTGCCTGTGAAGCAGGG + Intergenic
980792890 4:137642508-137642530 CCTGATTTGCCTGGGATTGTTGG - Intergenic
982452853 4:155573090-155573112 CCTCCCTTGGCTGGGGTTGAGGG - Intergenic
982655830 4:158148711-158148733 CCCCCTCTGCCTGGGGTGGGAGG - Intronic
984654730 4:182305693-182305715 CTGCCTTGGCCTTGGATGGAAGG + Intronic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
986333784 5:6737778-6737800 CCTCCGTTGCCTGGAATGCATGG + Intronic
987837999 5:23186453-23186475 TCTCCTGTGCCTGGCATGGCAGG + Intergenic
988544087 5:32140766-32140788 ACTCCATTGCCTGGGCAGGAGGG - Intronic
991364303 5:65852730-65852752 CCTCCTGTGCCTGGCTTGGCGGG - Intronic
991703776 5:69338704-69338726 CCTGATTTGCGTGGGATTGAGGG - Intergenic
992159086 5:73983231-73983253 CCTGGTTTGCCTGGGACTGAGGG - Intergenic
992872288 5:81019130-81019152 TCTCTTCTGACTGGGATGGATGG + Intronic
993801743 5:92351351-92351373 GCTTCTGTGCCTGTGATGGAGGG - Intergenic
994039673 5:95244526-95244548 CCTCCTATGCCTGGCTTGGCAGG + Intronic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
995642980 5:114278665-114278687 CCTCCTGTGCCTGGCTTGGCAGG - Intergenic
996638970 5:125730044-125730066 CCTCCTTTGGCTGGGGTGTGGGG - Intergenic
997115609 5:131122971-131122993 CCTCCTGTGCCTGGCTTGGCAGG - Intergenic
997592040 5:135080030-135080052 CCTCCCTAGCCTGGGGTTGATGG + Intronic
997621157 5:135297018-135297040 CTGCCTGTGCCTGAGATGGAGGG - Intronic
998218030 5:140252303-140252325 CCTCCGATGCCTGGATTGGAGGG - Intronic
998359612 5:141573754-141573776 CCTCCTTTGCCTGGGAGTGCTGG - Exonic
999450762 5:151676146-151676168 TCTCCTTTGCCTGGCCGGGAGGG - Exonic
999734609 5:154503536-154503558 ACTCAGTTGCCTGGGCTGGAGGG - Intergenic
1000319130 5:160119606-160119628 CCTACTCTGCGTGGGAAGGATGG - Intergenic
1000771694 5:165362771-165362793 CCTCTATTGCCCGGGCTGGAGGG + Intergenic
1000784600 5:165528360-165528382 CCTCCTAGGCCTGTGATGGGAGG - Intergenic
1002351761 5:178588943-178588965 CCTCCTTCTCCTGGGATAGATGG - Intronic
1006473402 6:34240595-34240617 CCTACTCTGCCCAGGATGGAGGG - Intronic
1006505870 6:34488225-34488247 GCTCCCTTGCCTGGTATTGATGG - Intronic
1006785806 6:36666391-36666413 CTTGGTTTGCCTGGGATTGAAGG + Intergenic
1006792738 6:36714422-36714444 CTTCCATTGCCTGGGCTGGAAGG - Intronic
1006828958 6:36957386-36957408 CCACCTTTGGCTGGGCTAGATGG + Intronic
1007318462 6:41008956-41008978 TCTCCCTTGACTGGGATTGAAGG - Intergenic
1007513992 6:42396771-42396793 CCTCAGCTGCCTGGGATGGTGGG + Intronic
1007819061 6:44547199-44547221 CTTCACTTACCTGGGATGGAAGG - Intergenic
1007876708 6:45111431-45111453 CCTAGTTTGCCTGGGATTGAGGG + Intronic
1009378568 6:63002118-63002140 TCTTCTTTCCCTGGGATGCAAGG + Intergenic
1010213802 6:73384060-73384082 ACTCTGTTGCCTGGGCTGGAGGG - Intronic
1011136264 6:84104303-84104325 GCCTCTGTGCCTGGGATGGAAGG + Intergenic
1011546594 6:88487960-88487982 CCTCCGTTGCCCAGGCTGGAGGG - Intergenic
1012209292 6:96500102-96500124 CCTCCTGTGCCTGGCTTGGTGGG - Intergenic
1013365446 6:109434204-109434226 CCTGGTTTGCCTGGGACTGAGGG - Intronic
1013368489 6:109451859-109451881 CCTCCTGGGCCTGGGACAGATGG - Intronic
1019267978 7:129462-129484 CCTCCCTGGCCTGGGTTGCAAGG + Intergenic
1019749681 7:2721171-2721193 ACGCCTGTGCCTGGGAGGGATGG + Intronic
1020145182 7:5636904-5636926 CTTCCCATGCCTGGGATTGATGG - Intronic
1020371364 7:7435493-7435515 CCTAGTTTGCCCGGGATTGAAGG - Intronic
1022454755 7:30548532-30548554 CACCCTTTGCCTGGGATGAGAGG - Intronic
1023122501 7:36924001-36924023 CCTCCTTGGCCTGGAGTGCAAGG - Intronic
1023146221 7:37153483-37153505 CCTCCTGTGCCTGGCTTGGCTGG + Intronic
1023599814 7:41870708-41870730 CCTGGTTTACCAGGGATGGAGGG - Intergenic
1025095739 7:56094124-56094146 GCTCTGTTGCCTGGGCTGGAGGG + Intergenic
1026223600 7:68421757-68421779 CCTCTGTTACCTGGGTTGGAGGG + Intergenic
1026852664 7:73734951-73734973 CCTCCTTGGCCTGGCAGGGGTGG + Intergenic
1029292549 7:99513425-99513447 ACCCTGTTGCCTGGGATGGAGGG + Intronic
1029981411 7:104882909-104882931 CCTCATTTGCCTGGGACTGAAGG + Intronic
1030331744 7:108278555-108278577 CCTCCTGTGCCTGGTGTGGCAGG - Intronic
1031920557 7:127597510-127597532 GCTCTGTTGCCTGGGCTGGAGGG + Intronic
1032782822 7:135177825-135177847 TCTCCTTTGCCTTCTATGGAAGG + Intergenic
1033008409 7:137592361-137592383 CCTGCTTTTCCTAGGAAGGAAGG - Intronic
1034603513 7:152287278-152287300 CCTCCACTGAATGGGATGGAGGG - Intronic
1034623573 7:152475212-152475234 CATCTTGTGCCTGGGTTGGAGGG + Intergenic
1034690206 7:153007886-153007908 ATTCCTTAGCCTGAGATGGAAGG - Intergenic
1034698455 7:153075664-153075686 CCTCCTTTGCTTGGGATAGTGGG + Intergenic
1035080753 7:156214095-156214117 GGTCCTTGGCCTGGGTTGGAGGG + Intergenic
1035274628 7:157740418-157740440 CCTGCCTTGCCGTGGATGGAGGG - Intronic
1035384149 7:158459248-158459270 CCCCCACTGCCTGGGATGAATGG + Intronic
1035384160 7:158459287-158459309 CCCCCACTGCCTGGGATGAATGG + Intronic
1036461076 8:8953326-8953348 GCTCTTTTCCCTGGGAAGGAAGG + Intergenic
1036683021 8:10889743-10889765 CCGCTTTTGACTGGGATGGATGG - Intergenic
1037660309 8:20920396-20920418 CCTCCTAGGCCTGTGATGGGAGG + Intergenic
1039267116 8:35837798-35837820 CCTCTGTTGCCTAGGCTGGAGGG - Intergenic
1039913416 8:41842457-41842479 GCTCTGTTGCCTGGGCTGGAGGG - Intronic
1040905648 8:52467390-52467412 CCTCCTTTGCCTGGAACGGCAGG - Intergenic
1041847728 8:62350722-62350744 ACTCTGTTGCCTAGGATGGAGGG + Intronic
1043317979 8:78944785-78944807 CCTCCTTAGACAGGGGTGGATGG + Intergenic
1043517199 8:81005784-81005806 GCATCTTTGCCTGGGAAGGACGG - Intronic
1046086576 8:109444166-109444188 CCACCTTAGGCTGGGATCGATGG - Intronic
1046352396 8:113032803-113032825 CCTCCTAGGCCTGGAATGGGAGG - Intronic
1047353705 8:124100141-124100163 CCTCCCTGCCCTGGGAAGGAAGG + Intronic
1048659003 8:136575129-136575151 CCTGCTTTGACAGGGATGCAAGG + Intergenic
1049536817 8:143186312-143186334 CCTCCTCTGCCAGGGCTGAAAGG + Intergenic
1049693128 8:143971454-143971476 CTTCCTGTCCCTGGGGTGGAGGG - Intronic
1050052871 9:1621668-1621690 CCTGGTTTGTCTGGGATAGAGGG - Intergenic
1050312338 9:4366395-4366417 CAACCTTTTCCTGGGATGGGAGG + Intergenic
1050407677 9:5327241-5327263 CCTCCTTTGCCTGGCTAGGCAGG + Intergenic
1052716527 9:32124630-32124652 TATCCATTGCCTGGGCTGGAAGG - Intergenic
1054928345 9:70610927-70610949 TACCCTTTGCCTGAGATGGAAGG + Intronic
1055335195 9:75226566-75226588 TCTCCTAGGCCTGTGATGGAAGG + Intergenic
1055481368 9:76711893-76711915 CCTCCGTTACCTGGGGTGAAAGG - Intronic
1055836343 9:80447450-80447472 GCTCCTTTGCCCTAGATGGAGGG + Intergenic
1056417421 9:86390286-86390308 CCTCCTGTGCCTGGCTTGGCAGG + Intergenic
1056965855 9:91162432-91162454 CCTTCTTTGCCTGTGAGTGATGG - Intergenic
1057215339 9:93224760-93224782 CCTCCAGTGTCTGGGAGGGAGGG + Intronic
1057306528 9:93915649-93915671 GCTCCTGTCCCAGGGATGGAGGG + Intergenic
1057607800 9:96513420-96513442 CATGCTTGGCCTGGGTTGGAAGG - Intronic
1057855742 9:98599580-98599602 CCCCCTCAGCCTGGGATTGAAGG - Intronic
1057891623 9:98874240-98874262 CCTCCTAAGCTTGGGGTGGAAGG + Intergenic
1057945457 9:99324160-99324182 CCTGGTTTGCCTGGGATTGTGGG + Intergenic
1058492910 9:105521217-105521239 CCTCATATTCCTGGGATGGAAGG + Intronic
1059367132 9:113794988-113795010 CCTGGTTTGCTTGGGACGGAGGG + Intergenic
1060002660 9:119972670-119972692 TCTGCTTTGCCTGGGCTGGAAGG - Intergenic
1060554419 9:124500862-124500884 TCTCCTTTGCCTGGCATTCAAGG + Intronic
1060977370 9:127772642-127772664 ACTCCTTTGGCTGGGATTGAGGG + Intronic
1061822755 9:133237711-133237733 CTTCCTTTGCCTCAGATGGGAGG + Intergenic
1061899626 9:133666259-133666281 CACCCTTTGCCTGGGGTGCAGGG - Intronic
1062206493 9:135340441-135340463 CCCCCTTTCCCTGGCATGGCTGG + Intergenic
1062278676 9:135742437-135742459 CCTCCTGTGCCTGGGCCAGATGG - Intronic
1062345238 9:136111364-136111386 CCTCGGTTGCCTGCGAAGGAGGG - Intergenic
1185639914 X:1584069-1584091 GCTCCTTTGCCCGGGTTGGAGGG + Intergenic
1187230590 X:17418532-17418554 CCTCCTTGGCATTGGATTGAAGG - Intronic
1188089978 X:25952716-25952738 CACCATTTGCCTGGGATGCAGGG + Intergenic
1188859977 X:35244556-35244578 GCACCTGTGCCTGGGATGGTGGG + Intergenic
1189725331 X:43963077-43963099 CCTCCTGTGCCTGGCAAGCAAGG - Intronic
1190078066 X:47333384-47333406 GCACCGTTGCCTGGGCTGGAGGG + Intergenic
1190738906 X:53275189-53275211 CCTCTGTTGCCTAGGCTGGAGGG + Intronic
1190817857 X:53944478-53944500 CCTCCTTTGGCTGGGCATGATGG + Intronic
1192185822 X:68946235-68946257 CCTCCTCTGCATGGGGTGGAGGG - Intergenic
1193477235 X:81981777-81981799 CCTCCTGTGCCTGGTTTGGCGGG + Intergenic
1193542445 X:82788591-82788613 CCTCCTGTGCCTGGCTTGGTGGG + Intergenic
1193719600 X:84971874-84971896 CCTCCCTTGGCTGGGAAGTAGGG + Intergenic
1194058284 X:89164195-89164217 CCTCCTTTGGCTGGGGTGGTGGG + Intergenic
1194688931 X:96957957-96957979 CCTCCTTTACCTGGAATGATGGG + Exonic
1195097238 X:101514822-101514844 TCTCCTTAGACAGGGATGGAAGG + Intronic
1198543531 X:137667388-137667410 TATCCTTTGACTGGAATGGAAGG - Intergenic
1200779245 Y:7199440-7199462 CCTCCTTCGCCTTCTATGGAAGG + Intergenic