ID: 903777123

View in Genome Browser
Species Human (GRCh38)
Location 1:25800291-25800313
Sequence GCGCGGCGGCGCGGTGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 2, 2: 12, 3: 59, 4: 493}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903777123_903777130 -2 Left 903777123 1:25800291-25800313 CCCGCGCCACCGCGCCGCCGCGC 0: 1
1: 2
2: 12
3: 59
4: 493
Right 903777130 1:25800312-25800334 GCCCGTTCCCTGGCGCTGCTCGG 0: 1
1: 0
2: 2
3: 4
4: 161
903777123_903777135 9 Left 903777123 1:25800291-25800313 CCCGCGCCACCGCGCCGCCGCGC 0: 1
1: 2
2: 12
3: 59
4: 493
Right 903777135 1:25800323-25800345 GGCGCTGCTCGGAGCCCTGCTGG 0: 1
1: 0
2: 1
3: 24
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903777123 Original CRISPR GCGCGGCGGCGCGGTGGCGC GGG (reversed) Exonic
900088678 1:909981-910003 GGGCGGCGGCGCGGCCGGGCTGG + Intergenic
900221683 1:1512488-1512510 GCGGGGCGGCGCGGGCGGGCGGG + Intronic
900244271 1:1630316-1630338 GCGCGGCGGGCCGGGGGCGGGGG - Exonic
900349818 1:2228960-2228982 GGGCGGCGGCTCGGTGGCTGCGG - Exonic
900353400 1:2247994-2248016 ACGGGGGGGCGCGGTGGCGGGGG + Intronic
900577982 1:3393845-3393867 GCGGGGCGGGGCGGGGGCGGGGG - Intronic
900629240 1:3624994-3625016 GCGCGGCCGGGTGGTGGCGGTGG + Exonic
901577247 1:10210805-10210827 GCGCGGGGGCGCGGGGGGCCGGG - Exonic
902586195 1:17439809-17439831 GCCGGGCGGGGCGGGGGCGCCGG - Intergenic
902813453 1:18902492-18902514 GCGCGGCGGAGCGCGGGCGCCGG + Exonic
903190275 1:21652169-21652191 GCGCGGCGGCTCGAGGGGGCGGG - Intronic
903349744 1:22710695-22710717 TCGCGGCGGCGCGCGGCCGCCGG + Intergenic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
903925230 1:26826923-26826945 GCGCGGCGGGGCGGGGGCGGCGG - Exonic
904794773 1:33051091-33051113 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
905124612 1:35708038-35708060 GCGGGGCGGCGCGTGGGGGCGGG + Intergenic
905617148 1:39409022-39409044 GCGGCGCAGCGCGGCGGCGCGGG + Intronic
905617153 1:39409030-39409052 GCGCGGCGGCGCGGGGAAGGGGG + Intronic
905647182 1:39632981-39633003 GTACCGCGGCGCGGTGGCTCCGG + Intronic
905847146 1:41242312-41242334 GCGGGGCGGCGCGCTGGAGGAGG + Intergenic
906197209 1:43936510-43936532 GCTCGTCGGAGCGGTGGCCCAGG - Exonic
906436877 1:45803817-45803839 GCGCGGCTGCGCTGCGGCCCGGG + Exonic
906486604 1:46240252-46240274 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
906640278 1:47437445-47437467 GCGCTTCGGCCCGGTGGCCCGGG + Exonic
907341337 1:53738328-53738350 GCGCCGCGGCGCGGGGGCCTGGG - Intergenic
907364126 1:53945845-53945867 CCGCGGTGGCGGGGTGGGGCGGG - Exonic
907883983 1:58576664-58576686 CGGCGGTGGGGCGGTGGCGCAGG + Exonic
908195370 1:61742390-61742412 GCGGGGCACCGGGGTGGCGCAGG - Intergenic
908473947 1:64470604-64470626 GCTCCGCGCCGCGGTGGCGAAGG - Intergenic
909443711 1:75724828-75724850 GCCCAGCGGTGCGGTGGGGCTGG + Intronic
910288810 1:85580872-85580894 GGGTGGCGGCGCGGTGGGCCCGG - Exonic
910632027 1:89364999-89365021 GGGCGGCGGGGGGTTGGCGCTGG - Intronic
910884591 1:91951455-91951477 GCGGGGCGGCAGGGTGGCGGGGG + Intronic
911072969 1:93846972-93846994 GCGCGGCGGCGCTCGCGCGCAGG + Intronic
912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG + Intronic
912824722 1:112894941-112894963 GCGCCGCAGCGCAGCGGCGCAGG - Intergenic
913714406 1:121519407-121519429 GCGCGGCGGCGAGAAGGCACTGG - Intergenic
913959462 1:143327618-143327640 GCGCGGAGAGGCCGTGGCGCCGG + Intergenic
914053822 1:144153191-144153213 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
914125324 1:144813174-144813196 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
915559229 1:156676767-156676789 GCGGGGCGGCGCGGGGCAGCGGG + Exonic
916022095 1:160801953-160801975 GCGCGGCGGTGAGGTGGGGATGG - Intronic
916651767 1:166839896-166839918 GCCCGGGGGCGCGGCGGCGGTGG + Intronic
916666994 1:166975589-166975611 GGGCGGCGGGGCGGAGGCGCGGG - Intronic
916694351 1:167221205-167221227 GAGCGGCGGCGGGGTGGGCCGGG - Intronic
916694394 1:167221312-167221334 CCGCGGCGGGGCGGCGGGGCCGG + Intronic
916802141 1:168225855-168225877 GCGCGGCGGGCCGGAGGGGCTGG - Intergenic
918066573 1:181105503-181105525 GCGGGGCGGGGCGGGGGCGGGGG + Intergenic
918487497 1:185045321-185045343 CCAGGGCGGGGCGGTGGCGCGGG + Intergenic
920886826 1:209937983-209938005 GCGCGGTGGGGCGGTGGGGTGGG + Intergenic
921207115 1:212858418-212858440 GCGGGGGAGCGAGGTGGCGCCGG + Exonic
921934856 1:220786955-220786977 GCGCGCCAGCGCGGAGGAGCCGG - Exonic
922766395 1:228158681-228158703 GGGCCGCGGCGCGGGGGCGGGGG - Exonic
923505269 1:234600139-234600161 GGGCGGCGGAGCGGAGGGGCGGG + Intergenic
923678592 1:236100973-236100995 GCGGGGCCGCGCGGTGTCGCTGG - Intergenic
1062857516 10:786651-786673 GTGCGGGGGCGGGGTGGGGCGGG + Intergenic
1063429787 10:5978045-5978067 TCGCCGCGGTGCGGAGGCGCGGG + Intronic
1063458957 10:6203455-6203477 GCGGGGCGGGGCGGAGGCGCGGG + Intronic
1063504033 10:6580228-6580250 CCGCTGCTGCCCGGTGGCGCTGG + Exonic
1063582909 10:7325247-7325269 GGGTGGGGGCGCGGTGGCTCAGG - Intronic
1063995088 10:11611518-11611540 GCGGCGCGGCGCGGCGGCGGCGG + Intronic
1063995089 10:11611521-11611543 GCGCGGCGCGGCGGCGGCGGCGG + Intronic
1064443228 10:15371423-15371445 GCGCGCCGGGGCAGTGTCGCCGG - Intergenic
1066126464 10:32347199-32347221 GCGCAGCGGCGCGGGCACGCGGG + Intronic
1068900982 10:62268833-62268855 GCGCGGCGGGGCGGGGGAGAGGG + Intergenic
1069019131 10:63465950-63465972 TGGCCGCGGCGCGGTGGCGGCGG - Intergenic
1069021430 10:63492525-63492547 GCGTGGTGGCGTGGTGGCGTGGG + Intergenic
1069024013 10:63521258-63521280 TGGCGGCGGCGCGTTGGCCCGGG - Intergenic
1069533696 10:69237756-69237778 ACACGGCGGCGCTGTGGTGCAGG + Intronic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1072591664 10:96832864-96832886 GCGTGGGGGAGGGGTGGCGCAGG - Intronic
1072950172 10:99840350-99840372 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1073076216 10:100827117-100827139 GCGCGGCCGCGCTGAGCCGCCGG - Intronic
1073306045 10:102504181-102504203 GGCCGGGGGCGCGGTGGGGCCGG - Exonic
1073403456 10:103277117-103277139 GCGCGGCGGGGCGGTGCGCCCGG - Intergenic
1074169734 10:110920000-110920022 GCGAGCCGGCGCGAGGGCGCGGG + Intronic
1074780399 10:116798165-116798187 GAGGGGCGGGGCGGTGGGGCGGG + Intergenic
1074829912 10:117241093-117241115 GAGCGGCGGCGGCGGGGCGCTGG + Exonic
1075430299 10:122374772-122374794 CCGCGGCGGCGCGGGTGCTCCGG + Exonic
1076373910 10:129971355-129971377 GTGCGTCGGCGCGGGGGCGGGGG + Intergenic
1076909281 10:133379220-133379242 GCGAGGGGGCGGGGAGGCGCTGG - Exonic
1077065538 11:639563-639585 GCGCGGGGGCGCCGGGGCGCGGG - Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1077891266 11:6419427-6419449 GTGCGGCGCCGCGGCCGCGCGGG + Intergenic
1077923161 11:6656003-6656025 GCGCGGCGCGGCGCTGGGGCCGG - Intergenic
1081872955 11:46391586-46391608 CCGCGGCGGCGCGGGGGCGGGGG - Intergenic
1082810478 11:57476508-57476530 GCGCTCCGGGGGGGTGGCGCAGG - Exonic
1083419760 11:62546212-62546234 TCGCGGAGGCGCGGAGGCGCTGG + Intronic
1083430774 11:62612720-62612742 GTGCTGCGGCGCTGTGGCACCGG - Exonic
1083684782 11:64369640-64369662 GCGGGGCGGAGCGGTGGCGCCGG + Intronic
1083883220 11:65558384-65558406 GCGCGGCGCGGCGGCGGCGAGGG + Intronic
1084124465 11:67089891-67089913 GCCGGGCGGCGCGGTGGCTCAGG + Intergenic
1085073691 11:73571885-73571907 GGGCGGTGGGGCGGTGGGGCAGG - Intronic
1085574423 11:77589761-77589783 GCGGGGAGGCGGGGAGGCGCGGG - Exonic
1087634440 11:100687133-100687155 GCGAAGGGGCGGGGTGGCGCTGG + Intergenic
1087672692 11:101127331-101127353 GCGCAGCGGTGCGCTGGGGCTGG + Intronic
1088315008 11:108498396-108498418 CCGCGGCGGCGAGGAGGGGCCGG + Exonic
1090238285 11:125165156-125165178 GCGCGGCGAGGCGGCGGCGGCGG - Intronic
1090238636 11:125166566-125166588 GCGCGGCGGGGCGGGAGCGGTGG + Intronic
1090327831 11:125904369-125904391 GCGGTGCGGCGCGCAGGCGCTGG - Exonic
1091558671 12:1594423-1594445 GGGCGTGGGCGCGGCGGCGCGGG - Intronic
1091823256 12:3491746-3491768 CGGCGGCGGCGCGGTGGTCCGGG - Intronic
1092250241 12:6891082-6891104 GCGGGACGGAGCGTTGGCGCTGG - Intronic
1092250253 12:6891133-6891155 GCGGGGCGGGGCATTGGCGCTGG - Intronic
1092461974 12:8695188-8695210 GCGGGGCGGGGCGGGGGGGCGGG - Intronic
1092487435 12:8914636-8914658 GCGGGGAGCCGCGGTCGCGCCGG + Exonic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094041108 12:26122614-26122636 GGGGGGCGGCGCGGCGGCGGCGG - Exonic
1094051670 12:26226984-26227006 GGGCGGAGGCGCGGTGGCCCCGG - Intronic
1095439296 12:42226950-42226972 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1095476150 12:42589404-42589426 GGGCTGCGGCGCGGTGGTGGGGG - Intronic
1096073565 12:48788930-48788952 GGGCGGCGGGGCGGGGGCCCAGG - Intronic
1096250976 12:50032570-50032592 GCGGGGTGGCGTGGGGGCGCGGG + Intronic
1096647635 12:53047332-53047354 GGGCGGGGGCGCGGCGGGGCGGG - Intronic
1096946737 12:55415005-55415027 GCGGGGAGCCGCGGTCGCGCCGG - Intergenic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1098161140 12:67649002-67649024 GCGAGGCGGCGACGAGGCGCCGG + Exonic
1098991183 12:77065852-77065874 GCGGGGCGGCGCGGGGCGGCGGG + Intergenic
1100385461 12:94101532-94101554 GCCCGGCGGGGCGCTGGAGCGGG + Intergenic
1100679895 12:96907446-96907468 GCGCGGCGGCGCGCTGGGCTGGG + Exonic
1102375715 12:112419290-112419312 GGGTGGGGGCGCGGTGGGGCCGG - Intronic
1103595502 12:122022416-122022438 GCGCGGCGGCCCGGAGGCGGCGG + Intronic
1103749866 12:123151150-123151172 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1103779398 12:123389108-123389130 CCGGGGCGCCGCGGCGGCGCTGG + Intronic
1104568420 12:129904361-129904383 GCGCGGACGCGCGGTGGCGGCGG + Intergenic
1105411859 13:20177528-20177550 GGGAGGCGGCGCGGTGGCCGCGG - Intergenic
1105413838 13:20192798-20192820 GCGCGGCGGGGCCGGGGCGGGGG + Intronic
1106248743 13:27968619-27968641 GCGCGGCGGCCGGGTGGTGCGGG + Exonic
1107133500 13:36920309-36920331 GCGCGGCGGCGGGCGGGGGCGGG - Intronic
1108074821 13:46668727-46668749 GCGGGGTGGCGGGGTGGCGGGGG + Intronic
1110860498 13:80341003-80341025 CGGAGGCGGCGCGGGGGCGCGGG + Intergenic
1112507165 13:99982013-99982035 TCGAGGCGGCGCGGAGGCGCAGG + Exonic
1112580565 13:100674149-100674171 AAGCGGCGGCTCGGTGGCCCCGG + Intronic
1113082723 13:106535178-106535200 GCGCGGCGGCGCGGCGGACTCGG + Intergenic
1113820660 13:113209878-113209900 GAGCGGGGGCGCCGGGGCGCCGG + Intronic
1113861505 13:113490490-113490512 GCGAGCCGGAGCGGTGGCGTCGG - Intronic
1113897916 13:113777495-113777517 GAGGGGAGGCGCGGTGGCCCCGG + Intronic
1113914838 13:113863974-113863996 GCGCCGCGGGGCGGAGGCTCCGG + Exonic
1114270689 14:21098363-21098385 GGGCGGCGGGCCGGCGGCGCGGG + Exonic
1114270765 14:21098530-21098552 GGGGGGCGGCGCGGCGGGGCTGG + Exonic
1115566638 14:34630191-34630213 GCGGGGCGGGGCGGAGGCGAAGG + Intergenic
1115761661 14:36582648-36582670 GCGGGGCGGGGCGGGGGCGGAGG - Intergenic
1116861788 14:50001327-50001349 GCGGGGCGGGGCGGGGGCGGGGG + Intronic
1116916779 14:50532728-50532750 GCGCGGTGGCGCGGTCGGGAGGG - Intronic
1117157039 14:52951271-52951293 GCGGGGCGGCGCGGGGGTGGCGG + Intronic
1117315354 14:54566833-54566855 GCGGCGCGGCGCGGGGGAGCCGG + Intergenic
1117964064 14:61189140-61189162 TCGCGGGGGCGCTGGGGCGCTGG - Intronic
1118030356 14:61812642-61812664 GCGGGGCGGCGCGGCGCGGCGGG + Intergenic
1119403250 14:74378560-74378582 GCGCGGGGGCCCGGAGGCCCTGG - Intergenic
1119500894 14:75126780-75126802 CGGCGGCGGCGCGGCGGAGCAGG - Exonic
1121101621 14:91253719-91253741 GCGGCGCGGGGCTGTGGCGCCGG + Exonic
1121226176 14:92323396-92323418 GCGAGTGGGCGCGGCGGCGCGGG + Intronic
1121368016 14:93332625-93332647 GGGCTGAGGCGCGGCGGCGCCGG - Intronic
1122271170 14:100568997-100569019 GCCCGGCGGGGCGGTGGGGGAGG - Intronic
1122384619 14:101335451-101335473 GCTCGGCGGCGCGGAGGCAAAGG - Intergenic
1122558127 14:102592439-102592461 GGGCGGCGGGGCGGGGGAGCGGG - Intergenic
1122581987 14:102777136-102777158 GCGCGGCGGCGGGGGCGCGGCGG + Intergenic
1122719857 14:103716000-103716022 GCGGGGCGGGTCGGAGGCGCTGG - Intronic
1122750326 14:103928305-103928327 GCGCGGCGGGGCGGGGCCGGCGG + Intergenic
1122964070 14:105112920-105112942 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1123036671 14:105474572-105474594 GGGCGGCGCCGCGGTCGCCCGGG + Intronic
1123869613 15:24557457-24557479 GCGTGGCGGGGCGGTGGTGGGGG - Intergenic
1124014219 15:25862606-25862628 GAGCGAGCGCGCGGTGGCGCAGG - Intronic
1127224983 15:56918931-56918953 GTGGGGCGGCGCGGCGGGGCTGG + Intronic
1128547750 15:68579231-68579253 CCGCGGCGGAGCGGGGGCGCGGG - Exonic
1129150286 15:73684190-73684212 GCGGGGCGGGGCGGGGGCGGGGG + Intronic
1129752821 15:78077685-78077707 CGGCCGCGGCGCGGAGGCGCAGG - Intronic
1129852279 15:78800298-78800320 ACGCGGCGGCGCGGCGGCCTGGG - Exonic
1130564526 15:84982078-84982100 CCGCGGCGGCCCGGAGGCGCCGG + Exonic
1131475384 15:92734215-92734237 GCGCGGCGGGGCGGAGGCGGAGG - Intronic
1131827209 15:96331300-96331322 GCGCGGCGTCGTCCTGGCGCTGG - Exonic
1131827373 15:96332041-96332063 GGGCGGCGGCGGGGCGGCGGCGG - Exonic
1132111595 15:99105711-99105733 TGGCGGCGGCGCGGCGGGGCCGG - Exonic
1132480574 16:164707-164729 GCGGGGCGGGGCGGGGCCGCGGG + Intronic
1132480611 16:164778-164800 GCGGGGCGGGGCGGGGTCGCGGG + Intronic
1132560201 16:590061-590083 GTGGGGCGGCGCGGCGGCCCTGG + Intronic
1132729116 16:1351953-1351975 CCGCTGCGGCGCGATGGCGGCGG + Exonic
1132741268 16:1414506-1414528 GCGCGGAGGCCGGGGGGCGCGGG + Intronic
1132828895 16:1918138-1918160 GGGGGCCGGCGCGGGGGCGCGGG + Exonic
1132947131 16:2537951-2537973 GCGCGGGGGCGGGGCGGCGCCGG + Exonic
1132968558 16:2673452-2673474 GCGCGGGGGCGGGGCGTCGCGGG - Intergenic
1134121342 16:11586854-11586876 GCGCGGGGACGCCGGGGCGCGGG - Intronic
1134134171 16:11668633-11668655 GCGCGGCGGCGGGGCCGGGCCGG + Intronic
1134531892 16:14989905-14989927 GCGCGGCGAGGCGGTACCGCTGG - Intronic
1135521589 16:23182549-23182571 GCGCGGCCGGGCTGGGGCGCAGG + Intergenic
1136535039 16:30894142-30894164 CCGGAGCGGCCCGGTGGCGCGGG + Exonic
1137988620 16:53130968-53130990 GCGTGGCGGCGCGGGGGAGGCGG + Intronic
1139364850 16:66427088-66427110 GGGCGGCGGCGCGGGGACGACGG + Intergenic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139489662 16:67279529-67279551 GCGCGGCCGCGCGGCGTCACGGG - Exonic
1139511481 16:67430803-67430825 GCGCGGCGGCTTGGCGGCCCCGG + Intronic
1139548519 16:67660950-67660972 GCGGGGCGGCGCGGGCGGGCCGG + Exonic
1139866488 16:70065949-70065971 GGGCGGCGGGGCGGCGGGGCGGG + Intergenic
1140033848 16:71358603-71358625 GCGCGGCGCGGCGGGGGCGGCGG - Intergenic
1141727472 16:85799408-85799430 GCGCGGCCGCGGGCTGGCGGGGG + Exonic
1141733164 16:85835621-85835643 GCACTGCGGCGCGGTGTCCCAGG + Intergenic
1142848157 17:2691979-2692001 GCGCGGCGGGGGCGTGGCGGGGG - Intronic
1142855126 17:2724803-2724825 GCACGGTGGCGCGGTGGCTGCGG + Intergenic
1144695885 17:17303605-17303627 GCGGGGCGGCGCGGGGCGGCGGG + Exonic
1144769573 17:17752200-17752222 GCGGGGCGGCGCGCGGGCGCAGG + Intronic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1145243607 17:21253326-21253348 GCGCGGCGGGGCTGGAGCGCGGG + Exonic
1145885747 17:28381401-28381423 GCGCCACTGCGCGCTGGCGCTGG + Exonic
1146057750 17:29589583-29589605 GAGCGGCGGCGGGGCGGCGCGGG - Intronic
1147963136 17:44179794-44179816 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1148323720 17:46771752-46771774 GCGGCGCGGCGCGGGGGCGGGGG - Intronic
1148493472 17:48037823-48037845 GCGCGGAGGCGGGGCGGCGGCGG - Intronic
1148615785 17:48998498-48998520 GCGGGGTGGCGCGGCGGCGGCGG + Intronic
1148787159 17:50150995-50151017 GCGCGGCGGCGGAGCGGCCCGGG - Intergenic
1148899601 17:50866109-50866131 GCGCGGCAGGGCGGGGGCGCGGG + Exonic
1150137612 17:62704201-62704223 GGGCGGCGGCGGGGAGCCGCGGG + Intronic
1150150963 17:62808398-62808420 GCGGGGCGGGGCTGTGGCCCCGG + Intergenic
1150217120 17:63476997-63477019 GCGCGGCGGGGCGGGGGCGGGGG + Intergenic
1150764633 17:67993571-67993593 GCGCGCCGCCGCGCTGGCCCCGG - Intronic
1151559173 17:74861557-74861579 GCGCGGCGGGGCGGGGGCGGGGG + Intergenic
1151716011 17:75831379-75831401 GCACGGCAGGGCGGTGGCGGAGG + Intronic
1152463815 17:80454872-80454894 GCGCGCCGCCGCGCTGGCTCCGG - Intergenic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152551993 17:81034767-81034789 AGGCGGGGGCGGGGTGGCGCAGG - Intergenic
1152729194 17:81961467-81961489 GCGGGGGGGGGCGGCGGCGCCGG - Intronic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1154202333 18:12308179-12308201 GAGCGGCGGGGCGGGGGCGGGGG + Exonic
1155054147 18:22170360-22170382 GTGCGGCGCCGCGGGGACGCCGG + Intronic
1159489074 18:69106207-69106229 GCGCTGGAGTGCGGTGGCGCTGG + Intergenic
1159586883 18:70289679-70289701 GCGCGACCTCGCGGTGGGGCGGG - Intronic
1160204665 18:76822755-76822777 GAGCGGCGGGGCGGGGGCGGGGG + Intronic
1160453597 18:78980676-78980698 GGGGGGCGGCGCGGCGGCGGAGG - Intronic
1160631263 18:80247584-80247606 GCGGGGCGGGGCGCGGGCGCGGG - Intergenic
1160668436 19:344511-344533 GCGCGGCGGCGCGGGGCGGGCGG - Intronic
1160668525 19:344724-344746 GCGCGGACGCGCGGGGGCGGGGG + Intronic
1160698822 19:496841-496863 GCGCGGAGGGGAGGGGGCGCAGG + Intronic
1160698933 19:497167-497189 GCGCGGAGGGGAGGGGGCGCAGG + Intronic
1160719100 19:589843-589865 GCGGGGCGGGGCGGAGCCGCGGG - Intergenic
1160736151 19:663239-663261 GCGGGGCGGAGCGGGGGCGCGGG + Exonic
1160853547 19:1206052-1206074 GCGGGGCGGCGCGGCGGCGGGGG - Intronic
1160860862 19:1236818-1236840 GAGCGGCGGGGAGGGGGCGCGGG + Intronic
1160896942 19:1407560-1407582 GGGCGGCGGCGCGGCGGCGCGGG + Intronic
1160961813 19:1725532-1725554 GCTCCGCGGCGCGGTCCCGCAGG + Intergenic
1160991814 19:1863267-1863289 GTGGGGCGCCGCGGCGGCGCCGG + Exonic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1160996682 19:1885302-1885324 GCGCGGCCGCGCGGGGTCCCGGG - Intronic
1161089130 19:2351536-2351558 GCGCTGTGGCGCTCTGGCGCCGG + Exonic
1161101817 19:2425276-2425298 GCCCGGGGCCGCGGTGGTGCGGG + Intronic
1161394005 19:4035153-4035175 GCTCGGCGGGGCGGAGGGGCTGG + Intronic
1161450632 19:4343610-4343632 GCCCAGCGGGGCGGAGGCGCGGG + Intronic
1161471259 19:4457709-4457731 GCCCGGCGGCGGGGGGCCGCGGG + Exonic
1161959460 19:7515968-7515990 GCGCGGCCGCGCGGTCGGGGTGG + Intronic
1162033161 19:7925937-7925959 GCGCGCCGGGGCGGGGGCGGTGG - Intronic
1162118160 19:8444848-8444870 GCGCGGCGGGGGCGTGGCCCGGG + Intronic
1162128237 19:8510867-8510889 GCGCGGCGGCCCGGCCGCGGGGG + Exonic
1162886642 19:13702551-13702573 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1162953533 19:14085740-14085762 GCGCGGCGGCGCGGCTCCGGTGG - Exonic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163725158 19:18919192-18919214 GCGCAGGGGCGCGGGGACGCTGG - Intronic
1163725161 19:18919200-18919222 GTGCGGCCGCGCAGGGGCGCGGG - Intronic
1164191861 19:22925298-22925320 GCGCGGCTGCGCTGCGGCCCAGG + Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1164653388 19:29901926-29901948 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1165058606 19:33194385-33194407 GCGGGGCGGCCCGGGGACGCCGG + Intronic
1165774039 19:38394762-38394784 GAGCGGAGGAGCGGCGGCGCTGG - Exonic
1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG + Intergenic
1166261380 19:41643977-41643999 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1166791705 19:45402631-45402653 GCGGGGCGCGGGGGTGGCGCGGG + Intronic
1166975121 19:46601343-46601365 GCGCGGACGCGCGGCGGAGCTGG + Exonic
1167311294 19:48739345-48739367 CCCCGGAGGCGCCGTGGCGCGGG + Exonic
1167368090 19:49065082-49065104 GGGCGGGGGCGGGGCGGCGCCGG + Intergenic
1167643781 19:50695247-50695269 GCCGGGGGGCGCGGGGGCGCGGG + Intronic
1168719068 19:58544913-58544935 GGGGGGCGGCGCCGAGGCGCTGG + Exonic
1202693090 1_KI270712v1_random:105034-105056 GCGCGGCGGAGAGGCGGCGGCGG + Intergenic
1202693298 1_KI270712v1_random:105849-105871 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
925377642 2:3399810-3399832 TGGCGGCGGGGCGGTGGCGGGGG - Intronic
925730598 2:6917517-6917539 GCGCGGGCGCGGGGAGGCGCGGG + Exonic
927213198 2:20651115-20651137 GGGCGGGGACGCGGTGACGCGGG - Intergenic
927713987 2:25341304-25341326 CCGCGGCGGCCCGGGGGAGCGGG - Intronic
927836345 2:26402103-26402125 GCGCAGCGATGCGGAGGCGCCGG - Exonic
927956769 2:27212306-27212328 GCGCTGCGGGGCGGGGCCGCGGG + Exonic
929583708 2:43100889-43100911 GTGCGGCGGCGCGGAGCCGGCGG + Intergenic
929778829 2:44944497-44944519 GAGCGGCGGCGCGGGGGAGCCGG + Intronic
931321348 2:61177324-61177346 GCGCGGGGACGCGGGGACGCGGG - Intergenic
931355851 2:61537507-61537529 GGGCGGCGGCGCGGCCGGGCGGG - Intronic
932591526 2:73070800-73070822 CCCCGGCGGCGCGGGGGCCCGGG + Intronic
933666713 2:84970829-84970851 GCGCGGCGCGGCGGCGGCGGCGG + Intergenic
933953270 2:87348710-87348732 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
934237501 2:90245055-90245077 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
934275689 2:91571610-91571632 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
934566972 2:95346589-95346611 CGGCGGCGGCGCGGCGGCGGGGG - Intronic
934566978 2:95346603-95346625 GCGCGGGGGCGCGGCGGCGGCGG - Intronic
935971506 2:108534412-108534434 GGCCGGCCGCGCGGGGGCGCGGG - Intronic
936531265 2:113278322-113278344 GCTCAGCGGCGCGGGGGCTCGGG + Intronic
937018931 2:118633073-118633095 GCGGGGCGGGGCGGGGGCGGGGG - Intergenic
938014748 2:127858091-127858113 GCGCGGCGCGGCGATGGCGGCGG - Exonic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
940316864 2:152335727-152335749 GCGCGGCGGCGGTCGGGCGCGGG + Intronic
940774945 2:157875889-157875911 GCGGGGCGGGGCGGTGCAGCCGG + Intergenic
942043348 2:172085169-172085191 GGGCGGCGGCGCGGAGCCGCTGG + Intronic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
942314200 2:174682945-174682967 GCGGGGCGGCGGGGGGGCGGCGG - Intergenic
942454743 2:176130070-176130092 GGGCGGCGGCGCGCGGGGGCTGG + Exonic
944114477 2:196171777-196171799 GCGCGGCGGCGTGGCGGCGCAGG + Intronic
946311200 2:218883537-218883559 GCGCGGGGGCGGGGCGGGGCGGG - Intronic
946843087 2:223837229-223837251 CCGCGGCGCCGCGTTGCCGCAGG + Intronic
947549899 2:231038225-231038247 GCGCGGGCGGGCGGTGGCTCGGG + Intronic
948609640 2:239158711-239158733 GGGCGGGTGCGCGGTGGGGCGGG - Intronic
948645226 2:239400436-239400458 GCCCGCCGGGGCGGGGGCGCGGG - Exonic
948801506 2:240435528-240435550 GGGGCGCGGCGCGGGGGCGCGGG - Intergenic
948805693 2:240452744-240452766 GCGCGGCGGGGCGGGGGCTGCGG + Intronic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
949014529 2:241702016-241702038 GCGCGGGCGGGCGGTGCCGCGGG - Intronic
949040079 2:241844033-241844055 GGTCGGGGGCGCGGGGGCGCGGG + Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079860 2:242088451-242088473 GGGCGGGGGCGGGGGGGCGCAGG - Intergenic
949079863 2:242088459-242088481 GCGCGGGGGGGCGGGGGCGGGGG - Intergenic
949079869 2:242088467-242088489 GCGCGGGGGCGCGGGGGGGCGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079883 2:242088491-242088513 GTGTGGGGGCGCGGGGGCGCGGG - Intergenic
1168757103 20:325520-325542 GCGCGCCGGCGGGGCCGCGCGGG + Exonic
1170204697 20:13785302-13785324 GGGCGGCGGGGCGGCGGGGCGGG + Intronic
1170348724 20:15416758-15416780 GCGGGGCGGTGGGGGGGCGCCGG + Intronic
1170585089 20:17728418-17728440 GCGGGGTGGAGCGGGGGCGCTGG - Intronic
1170756807 20:19212491-19212513 GGGCGGCGGCGCGGCGGGGGCGG - Intergenic
1171473591 20:25390744-25390766 GAGCGGCGGCACTGCGGCGCAGG - Exonic
1172037332 20:32019218-32019240 GAGCGGCGGCACGGAGGCGGCGG + Exonic
1172083231 20:32358705-32358727 GCGGGCTGGGGCGGTGGCGCGGG - Exonic
1172474452 20:35226654-35226676 GCGCGGAGGCGGGGGCGCGCTGG + Exonic
1172529310 20:35619118-35619140 GCGCGGGGGCGCGGGGGCTGGGG - Intronic
1172756590 20:37289662-37289684 GGGGAGCGGCGCGGCGGCGCGGG + Intronic
1175210482 20:57350923-57350945 GGGGGGCGGCGCGGGGGGGCGGG + Intergenic
1175562043 20:59939249-59939271 GCGCGGTGGCGCGGGCCCGCAGG - Exonic
1175562044 20:59939257-59939279 AGGCGGTGGCGCGGTGGCGCGGG - Exonic
1175715500 20:61252393-61252415 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1176148045 20:63574143-63574165 GGGCGGAGGGGCGGGGGCGCGGG - Intronic
1176194640 20:63831458-63831480 GCGCCGCGCCGCGGGGTCGCAGG + Intergenic
1176249904 20:64115659-64115681 GCACGGCTGTGCGGTGGCGCAGG + Intergenic
1176281625 20:64316745-64316767 GCGGGGCGCGGCGGGGGCGCGGG + Intergenic
1178417110 21:32412823-32412845 GCGCGGCGGGGCGGAGGCGCAGG - Exonic
1178707647 21:34888848-34888870 GCGCGGCGGCGGGGGCGCGCGGG - Intronic
1178915101 21:36701545-36701567 CCGCGGCCGCGCGGTAGGGCCGG - Intronic
1179563966 21:42234920-42234942 CCGCGGCGGAGCGGCGGCGCGGG + Intronic
1179957653 21:44750239-44750261 GCGCGGCGGGGTGCTGGCACCGG - Intergenic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1180614805 22:17120314-17120336 GCGCGGCGTGGTGGTGGTGCAGG + Exonic
1180959679 22:19756932-19756954 GCGCGGCGGGGCGGTGCCCTAGG + Intronic
1181068901 22:20320454-20320476 CCGCGGCCGAGCAGTGGCGCTGG + Intergenic
1181162041 22:20965137-20965159 GCGGGGGGGCGGGGAGGCGCGGG - Exonic
1182508620 22:30803071-30803093 GCGCGGCGGCGGGAAGGCGGCGG + Intronic
1182586322 22:31346092-31346114 GCGAGCCGGGGCGGGGGCGCCGG + Exonic
1182586343 22:31346160-31346182 GCGCACGGGGGCGGTGGCGCGGG + Exonic
1182804467 22:33058418-33058440 GCGCCGCGGCGCGGGGAGGCCGG - Intergenic
1183093744 22:35540451-35540473 GCGGGGCGCCGGGGTGGGGCGGG + Intergenic
1183149831 22:36028714-36028736 GCGGGGCGGCGCGGCGGGCCGGG - Intergenic
1183191071 22:36322399-36322421 GCGCGGCGGCGCCCCGGCTCTGG - Intronic
1183370125 22:37427487-37427509 GCGCGGCGGCGGGGAGGAGGGGG - Intergenic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183535623 22:38398929-38398951 GCGCGGGGGCGGGGTGGGGCGGG - Intergenic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1184086920 22:42270741-42270763 GCGCGGCGGGGGCGGGGCGCTGG + Intronic
1184347746 22:43923884-43923906 CGGCGGCGGGGCGGGGGCGCGGG - Exonic
1185343036 22:50300015-50300037 GGGCGGCGCCGAGGAGGCGCGGG - Intronic
1185413484 22:50697725-50697747 GCGGGGGGGCGCGGGGGGGCGGG + Intergenic
949993744 3:9600680-9600702 GGGCGGGGGCGCTGGGGCGCTGG + Intergenic
951485207 3:23202975-23202997 GCGCGGCCGCGAGGGGGCGGGGG - Intergenic
951558817 3:23945877-23945899 GTTCGGCGGCGCGCGGGCGCCGG + Intronic
951780194 3:26354464-26354486 GGGCGGCGGAGCGGGGGCGGGGG - Intergenic
952241348 3:31533401-31533423 GCGGGGCTCCGCGGCGGCGCGGG - Intronic
953404652 3:42654464-42654486 GCGCGGCGGGCGGGGGGCGCGGG - Intronic
954076851 3:48187994-48188016 GCGGGGCGGGGCGGTCGCGGCGG - Exonic
954198037 3:49007809-49007831 ACGCGGCCGCGCGGAGGCGGAGG + Intronic
954812237 3:53255536-53255558 GCGCAGCTGCATGGTGGCGCGGG - Intronic
955356590 3:58237466-58237488 GCGGGGCGGGGCGGGGGCGGGGG + Intergenic
956596521 3:70973233-70973255 GCGGGGCGGGGCGGGGGCGGGGG - Intronic
956675018 3:71725272-71725294 GAGCGGCGGCTCGGGGGCGGCGG + Exonic
959085783 3:101849574-101849596 GCGCAGCGAGCCGGTGGCGCAGG + Exonic
961654295 3:128432961-128432983 GGGCGGCGGGGCTGGGGCGCGGG - Intergenic
961696603 3:128709641-128709663 GCGCGGGGGCGGGGTGTGGCGGG - Intergenic
961735811 3:129001616-129001638 GCGCGGCGCAGCGATGGAGCCGG + Exonic
963870301 3:150408720-150408742 GGGCGGTGGGGCTGTGGCGCGGG - Exonic
966874519 3:184314758-184314780 GGGCGCCGGGGCGGCGGCGCAGG - Intronic
967685274 3:192409901-192409923 AGGCGGCGGCGCGGCGGCGGGGG - Intronic
967867804 3:194204371-194204393 GCGCGGCGGGGCGTGCGCGCCGG - Intergenic
968372752 4:11005-11027 CCGCCGCGGCGCCGTGGCGGTGG + Intergenic
968433846 4:575257-575279 GCGCGGCCCCGCGGCGGCTCCGG - Intergenic
968434127 4:576251-576273 GCGCGGGGTCGCGGCGGCGGCGG - Intergenic
968508963 4:987093-987115 GCAGCGCGGCGCGGGGGCGCAGG - Exonic
968584126 4:1408060-1408082 GCGGGGCGGGGGGGGGGCGCAGG + Intergenic
968636645 4:1684371-1684393 TCGCGGCGGCGGCGGGGCGCGGG - Intergenic
968640510 4:1712288-1712310 GAGCGCCGGCGCGGGGACGCGGG - Exonic
968834846 4:2955585-2955607 GCCAGGAGGCGCTGTGGCGCAGG - Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
968879896 4:3293309-3293331 GCGGGGCGGGGCGGGGGCGGGGG + Intronic
968965127 4:3765854-3765876 GCGCAGCGGGGCGGGCGCGCGGG - Intergenic
969611909 4:8232204-8232226 GGGCGGCGGGGCGGGGGCACAGG + Intronic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
970637052 4:18021447-18021469 GCGGCGCGGCGCGGCGGCCCCGG - Intronic
971244101 4:24912973-24912995 GCGCAGCGGCTCGGAGGCGCCGG - Intronic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
972396570 4:38663866-38663888 GCGCGGCGCGGCCGTGGGGCTGG - Intergenic
973774798 4:54233177-54233199 GCGCAGGGGCGCAGGGGCGCAGG + Intronic
973954405 4:56049019-56049041 GCCGGGCGGGGCGGCGGCGCGGG + Intergenic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
975821021 4:78270534-78270556 GCGGGGGGGCGGGGTGGCGGGGG - Intronic
977257726 4:94758520-94758542 GCCCGGCGGGGCGGGGGCCCAGG + Intronic
979349264 4:119627300-119627322 GGGCGGCGGCGCGGAGGCCGGGG - Intronic
979674652 4:123398279-123398301 GCCCGGCCGCGCGGAGCCGCGGG + Intronic
979674815 4:123398796-123398818 GAGCGGCGGCGCGGTGGCCCAGG + Intronic
979785680 4:124712795-124712817 GAGCGGCGGGGCGGGGGCGGGGG - Intergenic
982616151 4:157637978-157638000 GCGCGGCTGCGCTGCGGCGCGGG - Intergenic
983649779 4:170026466-170026488 GCCGGGCGGCGCGGAGGCGCGGG + Intronic
984771014 4:183436307-183436329 ACGCGGCGGTGGGGTGGGGCGGG + Intergenic
985462642 4:190121561-190121583 CCGCCGCGGCGCCGTGGCGGGGG - Intergenic
985695596 5:1338382-1338404 GGGAGGCGGAGCTGTGGCGCAGG + Intronic
985896301 5:2751573-2751595 GGGCGGCGGCGGGGTGGCGGTGG + Exonic
985994741 5:3591676-3591698 GGGCCGCGGCTCGGTGGCGACGG - Intergenic
987058441 5:14218608-14218630 GCGAGGCTGCGCAGTGGGGCTGG + Intronic
987374009 5:17217825-17217847 CCGCGGCGGCGCGGGGCCACCGG - Intronic
989375507 5:40756127-40756149 GCGAGGCTGCGCGGTACCGCGGG - Intergenic
992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG + Intronic
992373664 5:76170851-76170873 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
995854085 5:116574642-116574664 GGCCGGCAGCGCGGTGCCGCGGG + Exonic
997635128 5:135399060-135399082 ACGCGGCGGCTCGGTGGCGGCGG + Exonic
998353003 5:141513330-141513352 GGGCGGGGGCGGGTTGGCGCCGG + Intergenic
999268822 5:150284553-150284575 GGGCGGCTGCGCGGGGGCGGAGG + Intronic
1000985194 5:167858621-167858643 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1002021228 5:176365602-176365624 GGGCGGCGCCGCGGCGGTGCTGG + Exonic
1002219954 5:177672259-177672281 GGCCGGCGGGGCGGTGGCCCGGG - Intergenic
1002341468 5:178519027-178519049 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1002888162 6:1313400-1313422 GCGGGGCGGCGGGGAGGCCCGGG - Exonic
1002897933 6:1389969-1389991 GCGCGGCGGAGCGGGGCCGGCGG - Exonic
1003058224 6:2841781-2841803 GGGCCTCGGAGCGGTGGCGCGGG - Intronic
1003112128 6:3259222-3259244 GGGCGGCGGGGCGGGGGCGCGGG + Intronic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003645605 6:7910872-7910894 GCGCGCCGGCGCGGGCGGGCGGG - Intronic
1004167993 6:13273899-13273921 GCGGGGCGGGGCGGGGGGGCCGG - Intronic
1005912966 6:30326904-30326926 GCGCCGCGGGGCGGGGGCGAGGG + Exonic
1006642453 6:35496381-35496403 GCGCGGTGCCGCGGCTGCGCTGG - Intronic
1006834022 6:36986068-36986090 TCGCGGCGGAGCGGCGGCGGGGG - Exonic
1007072728 6:39048845-39048867 GCGCAGCGGGCCGGGGGCGCCGG - Exonic
1007631387 6:43275311-43275333 CCTCGGCGGCGGGGTGGGGCGGG - Intronic
1007674483 6:43581777-43581799 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1010703455 6:79078342-79078364 GCGCCGGGGGGCGGGGGCGCGGG - Intergenic
1011434473 6:87322482-87322504 GCGCAGCGGCGCGGGGCTGCGGG - Intronic
1011448958 6:87472949-87472971 GCGCGGGGGCGCGGAGGGGGCGG + Intronic
1012410120 6:98947627-98947649 AAGCGGAGGCGCGGGGGCGCGGG + Intronic
1012410123 6:98947635-98947657 GCGCGGGGGCGCGGGGCCGCGGG + Intronic
1012895502 6:104941454-104941476 GCGGGGCAGGGCGGGGGCGCAGG + Intergenic
1012916880 6:105179997-105180019 CCGGAGCGGCGCGGCGGCGCGGG + Intergenic
1014098245 6:117482799-117482821 CGGCGGCGGCGCACTGGCGCGGG + Exonic
1014137592 6:117907393-117907415 GCGCGGGGGCGCGGAGCTGCCGG - Intergenic
1015476483 6:133664081-133664103 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1015773538 6:136792276-136792298 AGGCGGCGGCGCGGCGGCGAGGG - Exonic
1015786101 6:136922571-136922593 GCTCAGCGCCGCGGTGGAGCTGG - Exonic
1016010830 6:139135785-139135807 CCGCGGCGGGGCGGAGGGGCGGG - Intronic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1016328227 6:142927009-142927031 GCGCGGCGGCGCGGGGCGGGCGG + Intronic
1016340904 6:143060793-143060815 GCGGGGCGGGGCGGGGGCGGGGG - Intronic
1016982317 6:149864389-149864411 GCGGGGCCGCGCGGGGGGGCGGG - Intergenic
1016982323 6:149864397-149864419 GCGCGGGGGCGGGGCCGCGCGGG - Intergenic
1017662404 6:156687363-156687385 GCGCGGCGGCGCGAGGGTTCCGG + Intergenic
1017671821 6:156777163-156777185 GCGCGGCGGCGTGGGGCGGCCGG - Intergenic
1017672009 6:156777812-156777834 GCGCGGCGCGGCGGCGGCGGCGG + Intergenic
1018017810 6:159727604-159727626 GTCCGGCTGCGCGGTGGCCCGGG + Intronic
1019310980 7:360514-360536 GCGGGGCGACGTGCTGGCGCTGG - Intergenic
1019406324 7:885996-886018 GCGGGGGAGCGCGGTGGCGAGGG + Intronic
1021740349 7:23680239-23680261 TCTCGGCGGCGCGGCGGCGGTGG + Exonic
1021761222 7:23904748-23904770 GCGTGGCGGCGTGGGGGCGGGGG + Intergenic
1022207722 7:28180141-28180163 GCGGGGCGGCGGGGTTGCGGCGG - Intronic
1022410319 7:30134949-30134971 GCGCGGCGCCGCGCTGTCCCCGG + Exonic
1022427963 7:30285580-30285602 GAGCGGCTGCGCGGGGCCGCCGG - Exonic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1023287105 7:38631398-38631420 TGGCGGCGGCGCGGAGGAGCGGG + Exonic
1023937264 7:44748863-44748885 GGGCGGCGGCGCGATGGCGCGGG + Intronic
1024323236 7:48089572-48089594 GCGCGGCTGCGCGGGGAGGCGGG + Intronic
1024639360 7:51316849-51316871 GCGGCGCGGGGCGGGGGCGCCGG + Intergenic
1025106561 7:56175510-56175532 GCGCGGCGGCGCGGGGTCCTCGG + Intergenic
1026004806 7:66592182-66592204 GCGGGGCGGCGAGGTGTCTCGGG - Intergenic
1026850323 7:73719573-73719595 GGGCGGCCGCGCGCTGGGGCCGG + Intronic
1026923806 7:74174780-74174802 GCGGGGCTGAGCTGTGGCGCTGG + Intronic
1028417578 7:90596342-90596364 GGGCGGCGGCGGCGCGGCGCGGG + Intronic
1028621582 7:92834003-92834025 GCGCGGGGGAGGGGAGGCGCCGG + Intronic
1029238701 7:99143682-99143704 GCGAGGGGGCGCCGGGGCGCGGG + Intronic
1029238728 7:99143810-99143832 GGGCTGGGGGGCGGTGGCGCTGG - Exonic
1029896506 7:103989744-103989766 GCGGGGCGGCGCGCGGGGGCGGG - Intergenic
1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG + Intergenic
1031317255 7:120273310-120273332 GCTCGGCAGCGCGGGGGCGCGGG - Intergenic
1031361826 7:120857365-120857387 GGGCGGCGGGGCGGGGGCGGGGG + Intronic
1031986544 7:128167693-128167715 GGGCGCCGGCGAGGTGGCGAGGG + Intergenic
1031986554 7:128167722-128167744 GCGCGGGGGCGCGGGAGCCCCGG + Intergenic
1032174560 7:129612307-129612329 GGCGGGCGGCGCGGTGGGGCCGG + Intronic
1032237927 7:130140900-130140922 GCGCGGCGGCGCCGGGCTGCGGG - Intergenic
1032337841 7:131042865-131042887 GCATGGCGGCGGGGTGGGGCTGG - Intergenic
1033220399 7:139523652-139523674 GCGAGGCGGCGCGCGGGAGCCGG - Intergenic
1033595332 7:142854924-142854946 GCGCGCCGGGGCGGAGGAGCGGG + Intergenic
1033644201 7:143288327-143288349 GCGCGGCAGGGCGCAGGCGCAGG + Exonic
1034129149 7:148699331-148699353 AGGCGGCGGCCTGGTGGCGCCGG + Intronic
1034228034 7:149497859-149497881 GCGGGGCGGGGCGGGGCCGCGGG - Intergenic
1034418723 7:150978182-150978204 GCGCGGGGACGCGGCGGAGCGGG - Exonic
1034445930 7:151114517-151114539 GCGGCGCGGCGCGGGGGAGCCGG - Intronic
1035160821 7:156949157-156949179 GCGGGTCGGCGCGGTGCCGGAGG - Intergenic
1035747927 8:1974606-1974628 GAGCCGCGGCGCGGTGGGGCGGG - Intronic
1036910712 8:12755187-12755209 TCGCGGCGGCGCTGCGCCGCGGG - Exonic
1037297195 8:17413503-17413525 GCGCGTCGCGGCGGCGGCGCAGG - Intronic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1038883593 8:31640035-31640057 GGGCGGCGGAGCCGGGGCGCTGG - Intronic
1039212694 8:35235348-35235370 GGGCGGTGACGCGGCGGCGCTGG - Intergenic
1039476608 8:37842181-37842203 GGGCGGCGGCGCGCTGGAGAAGG + Exonic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1040038844 8:42896776-42896798 GCGCGGCGGCGCGGGTCGGCCGG + Intronic
1041281079 8:56211540-56211562 GCTGGGGGGCGCGGTGGGGCGGG + Intergenic
1041910707 8:63085920-63085942 GCCTGGCGGCGCTGCGGCGCCGG - Exonic
1043463857 8:80486552-80486574 GCGCGGCGGGGCGGGGGTGGAGG + Exonic
1043502943 8:80874262-80874284 GCGGGGCGGCGCGGCGGCCGCGG + Intronic
1045535182 8:103021004-103021026 CTGCGGCTGCGCAGTGGCGCGGG + Intergenic
1045663970 8:104466631-104466653 GGGCGGGGGCGCGGCGGGGCGGG + Intronic
1049756559 8:144313644-144313666 GCGCGGCGGGGAGGCGGGGCGGG - Intronic
1049756582 8:144313691-144313713 GGGCGGCGGCGCGGGGAGGCGGG - Intronic
1049756586 8:144313699-144313721 GGGAGGCGGGGCGGCGGCGCGGG - Intronic
1049756602 8:144313733-144313755 GCGGGGAGGCGGGGAGGCGCGGG - Intronic
1050845206 9:10208231-10208253 GCGGCGGGGCGCGGTGGCTCAGG + Intronic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1053306143 9:36986086-36986108 GCGCGCCGGGGCGAGGGCGCCGG - Intronic
1053435155 9:38069281-38069303 GGGGGGCGGGGCGGCGGCGCGGG - Intergenic
1053457017 9:38241342-38241364 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1056413459 9:86354504-86354526 GCGCGGCGGAGCGCTAGGGCGGG - Intergenic
1057146937 9:92764847-92764869 GTGCGGCGGCGCGGGCGGGCGGG - Intergenic
1057313450 9:93955244-93955266 TCGGGGCGGCGCGCGGGCGCCGG + Exonic
1057313501 9:93955395-93955417 GCGGGGCGGGGCGGTGACGCGGG - Intergenic
1057432163 9:95004731-95004753 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057432187 9:95004783-95004805 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057432227 9:95004935-95004957 GGGCGGCGGCGCGGGCGGGCGGG - Intronic
1057432338 9:95005297-95005319 GCGCTGCGGCGCGCGGGTGCGGG + Intronic
1057490473 9:95516301-95516323 GCGCGCCGGGGCCGTGGAGCCGG - Intronic
1057832687 9:98419095-98419117 GCCCGGGGGGGCGGTGGAGCAGG + Intronic
1059102534 9:111484051-111484073 GCGCGGCGGCGCGGTTAGGCCGG - Exonic
1059176731 9:112175142-112175164 CCGCGGCGCCGCGGGAGCGCCGG - Exonic
1059210809 9:112513502-112513524 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060064729 9:120494855-120494877 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060209096 9:121699477-121699499 GGGCGGCGGCGCGGGGGACCGGG - Intronic
1060263168 9:122093187-122093209 GGGCGGCGGAGCGGCGGCGGCGG - Exonic
1060811740 9:126614285-126614307 GAGCGGCGACGCGCTGGCCCCGG - Intergenic
1061248374 9:129413272-129413294 GCGGCGGGGCGCGTTGGCGCGGG - Intergenic
1061317109 9:129803230-129803252 GCTCCGGGGCGCGGCGGCGCTGG + Exonic
1061368910 9:130187038-130187060 GAGAGGCGGGGCGGGGGCGCGGG + Intronic
1061453553 9:130681763-130681785 GCGGGGCTCCGCGGCGGCGCCGG - Exonic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1062349852 9:136133309-136133331 GCGCGGCTGCGGGGCGGGGCGGG - Intergenic
1062507619 9:136886227-136886249 GCGCGCCGGGGCGTTGGTGCGGG - Intronic
1062507668 9:136886458-136886480 ACGCGGCGGAGCGGCGGCGGCGG + Intronic
1062558860 9:137130179-137130201 GCGCGGCGTCGCGGGGGCCGAGG + Intergenic
1062567313 9:137168955-137168977 GGGCGGCGGTGCGGAGGCGGCGG + Exonic
1062574580 9:137200263-137200285 CCGCGGCGGCGCGGCGCGGCGGG + Exonic
1062659094 9:137619068-137619090 GGGGGGCGGCGCGGGGGCGGCGG + Intronic
1186426087 X:9465193-9465215 CGGCGGCGGGGCGGGGGCGCTGG - Exonic
1186426133 X:9465316-9465338 GCGCGGCTGCTCCGGGGCGCCGG + Exonic
1187768181 X:22666509-22666531 GCGGGGCGGGGCGGGGGCGGGGG - Intergenic
1189374330 X:40454883-40454905 GCCGGGCGGCGCGGTGGCTCAGG - Intergenic
1189534519 X:41923183-41923205 GGGCGGCGGGGCCGGGGCGCGGG + Intronic
1190789585 X:53686458-53686480 GCGCGGAGGCGCGGAGGTGGCGG - Intronic
1196763639 X:119223201-119223223 GCGAGGCGGGGCTCTGGCGCGGG + Intergenic
1197655147 X:129108658-129108680 GCGCGGCGGGGCGGTGGGGTGGG + Intergenic
1199445103 X:147912040-147912062 GTGCGGCAGCGCGGCGGCGGCGG + Exonic
1199771141 X:150976081-150976103 GAGCAGGGACGCGGTGGCGCTGG + Intergenic