ID: 903777123

View in Genome Browser
Species Human (GRCh38)
Location 1:25800291-25800313
Sequence GCGCGGCGGCGCGGTGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 2, 2: 12, 3: 59, 4: 493}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903777123_903777135 9 Left 903777123 1:25800291-25800313 CCCGCGCCACCGCGCCGCCGCGC 0: 1
1: 2
2: 12
3: 59
4: 493
Right 903777135 1:25800323-25800345 GGCGCTGCTCGGAGCCCTGCTGG 0: 1
1: 0
2: 1
3: 24
4: 282
903777123_903777130 -2 Left 903777123 1:25800291-25800313 CCCGCGCCACCGCGCCGCCGCGC 0: 1
1: 2
2: 12
3: 59
4: 493
Right 903777130 1:25800312-25800334 GCCCGTTCCCTGGCGCTGCTCGG 0: 1
1: 0
2: 2
3: 4
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903777123 Original CRISPR GCGCGGCGGCGCGGTGGCGC GGG (reversed) Exonic