ID: 903779590

View in Genome Browser
Species Human (GRCh38)
Location 1:25812806-25812828
Sequence CTGGATCTAAGGGGAGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903779573_903779590 28 Left 903779573 1:25812755-25812777 CCTGCTGTGGGGGGCCCTGGATG 0: 1
1: 0
2: 1
3: 28
4: 241
Right 903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 159
903779580_903779590 4 Left 903779580 1:25812779-25812801 CCAGTCCTGCTGAGGTGAGGGGC 0: 1
1: 0
2: 3
3: 27
4: 234
Right 903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 159
903779574_903779590 14 Left 903779574 1:25812769-25812791 CCCTGGATGACCAGTCCTGCTGA 0: 1
1: 0
2: 1
3: 16
4: 109
Right 903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 159
903779575_903779590 13 Left 903779575 1:25812770-25812792 CCTGGATGACCAGTCCTGCTGAG 0: 1
1: 0
2: 0
3: 15
4: 178
Right 903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 159
903779582_903779590 -1 Left 903779582 1:25812784-25812806 CCTGCTGAGGTGAGGGGCCCGGC 0: 1
1: 0
2: 2
3: 19
4: 229
Right 903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG 0: 1
1: 0
2: 0
3: 19
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903779590 Original CRISPR CTGGATCTAAGGGGAGCAGT GGG Intronic
901203763 1:7482392-7482414 CTGGACCTAGGGGCAGCTGTGGG - Intronic
902089155 1:13889253-13889275 CTGGATCTAAGAAGAGAAGTAGG - Intergenic
903779590 1:25812806-25812828 CTGGATCTAAGGGGAGCAGTGGG + Intronic
904027919 1:27516296-27516318 CTATATCTAAGGGGAGAACTGGG + Intergenic
904948424 1:34216176-34216198 CTGGAACTCAGGGGAGAGGTTGG + Intronic
906552643 1:46678468-46678490 CTGGAGCTAAGGGTAGCTTTAGG - Exonic
909942611 1:81627876-81627898 CAGGATCTAAGCACAGCAGTGGG - Intronic
912345266 1:108957791-108957813 ATGAAGCTAAGGAGAGCAGTGGG + Intronic
912857047 1:113178442-113178464 GTGGATCTCAGGGGAGCTGTGGG + Intergenic
913396012 1:118373570-118373592 CTTGATCTCATGGGAGAAGTTGG - Intergenic
913498959 1:119453069-119453091 TTGGATCCCAGGGGAGCAGCTGG + Intergenic
913502380 1:119483126-119483148 CTGAATCTCAGGGGAGCAGCTGG + Intergenic
913506157 1:119517740-119517762 CTGGATCTCAGGGGAACAGCTGG + Intergenic
913506168 1:119517807-119517829 CTGGATCTCAGGGGAACAGCTGG + Intergenic
913506178 1:119517874-119517896 CTGGATCTCAGGGGAACAGCTGG + Intergenic
913510191 1:119554285-119554307 CTGGATCTCACAGGAGCAGCTGG + Intergenic
913514014 1:119587406-119587428 CTGGATCTCATGGCAGCAGCTGG + Intergenic
914492313 1:148160181-148160203 CCGGTTCTATGAGGAGCAGTGGG + Intergenic
915117329 1:153609039-153609061 CAGGATATGAGGGGAGCAGGCGG + Intronic
915960385 1:160262012-160262034 CTCAATCTAAGGGGAGAAATAGG + Intronic
916365520 1:164022895-164022917 CTGCATCCAAGATGAGCAGTGGG - Intergenic
917402349 1:174664623-174664645 CTAGATCTAAGAGGAGCACCTGG - Intronic
1066976072 10:42368759-42368781 TTGGATCTGAGGAGAGAAGTTGG - Intergenic
1067828412 10:49596081-49596103 CTGGGTCTAAAGGGATCAGCGGG + Intergenic
1069343356 10:67439006-67439028 CTGGCTCTAAGCTCAGCAGTAGG - Intronic
1069731557 10:70618949-70618971 GTGGTTCGGAGGGGAGCAGTGGG + Intergenic
1069869833 10:71526366-71526388 CTGGGTCCAAGGTGAGCAGAGGG + Intronic
1069871718 10:71537072-71537094 ATGGAGCTGGGGGGAGCAGTTGG - Intronic
1069895688 10:71678955-71678977 CTGGGTGTAAGGGGACCAATGGG + Intronic
1070827904 10:79401811-79401833 CTGGAGCCAAGAGGAGCAGGGGG + Intronic
1071119767 10:82264103-82264125 CTGGAACTCAGGGGAGAAATAGG + Intronic
1072238332 10:93472334-93472356 CAGGATCTATGGAGAACAGTAGG + Intronic
1073668651 10:105562361-105562383 CTGGGTCTTCTGGGAGCAGTGGG + Intergenic
1073967868 10:109012421-109012443 CTGAATCCAAGGGGAGGAGGAGG + Intergenic
1074371349 10:112903129-112903151 CTTGATCTCAGGGGAGCTGCAGG + Intergenic
1077301403 11:1848814-1848836 CTGGATTTGAGGGGAGAAGCCGG - Intergenic
1079019636 11:16898832-16898854 TTGGATTTTAGAGGAGCAGTTGG - Intronic
1079152203 11:17910104-17910126 TTGGATCTTAGGGGAACTGTAGG - Intronic
1079247073 11:18760518-18760540 CAGGATCTAAGGTGAAGAGTAGG + Intronic
1085342756 11:75744064-75744086 CTGGCTCTCAGGGGAGGAGACGG - Intergenic
1088888795 11:114028824-114028846 CTGGATGTAAGGAGGACAGTGGG - Intergenic
1092255789 12:6926263-6926285 CTGGGTCACAGGGAAGCAGTCGG - Intronic
1093294458 12:17370811-17370833 GTGGATCTCAAGGGAGGAGTGGG + Intergenic
1095714085 12:45322610-45322632 CTGGATGCAAGGAGACCAGTGGG + Intronic
1097183432 12:57183899-57183921 CTGGATCGCAGGTGAGCAGTGGG + Exonic
1098142187 12:67461384-67461406 CTGGCTCTAAGGTCACCAGTAGG + Intergenic
1098377442 12:69832341-69832363 CTGGCTCTTAGGAGAGCAGCAGG - Intronic
1100617194 12:96239934-96239956 CAGCATCTAAGCGGAGCACTTGG + Intronic
1104510629 12:129374546-129374568 CTGGAGCTGAAGGGAGCAGGTGG + Intronic
1104676419 12:130714944-130714966 CGGTTTCTAAGGGGAACAGTGGG - Intronic
1106120711 13:26858118-26858140 CTGCATGTAAGGGGAGAAGGTGG - Intergenic
1107023378 13:35774857-35774879 CTGGATTTGTGGGGAGCAGAGGG - Intronic
1111070247 13:83156818-83156840 CCGGATTTAAGGGTAGCAATAGG + Intergenic
1112727311 13:102319352-102319374 CTGTATCTAAGCAGAGCAGGGGG - Intronic
1115376155 14:32678171-32678193 TTGGATTTAATGGGATCAGTTGG - Intronic
1120915059 14:89703255-89703277 GTGGATCTAAGTGGTGCAGGGGG - Intergenic
1124435071 15:29641235-29641257 CTTGATCTTAGGGGAAAAGTAGG - Intergenic
1125615414 15:41007697-41007719 CTTGAACTAAGACGAGCAGTGGG + Intronic
1125717347 15:41826894-41826916 CTGCAGCAGAGGGGAGCAGTAGG - Exonic
1126755796 15:51923670-51923692 CTGGAGCTATGGGGAGCTCTGGG - Intronic
1128374149 15:67064020-67064042 CTGAATCAAAGGGCAGCAGGCGG + Intronic
1128567679 15:68711922-68711944 CTGGAGGTAGGGGGTGCAGTGGG - Intronic
1128780431 15:70355487-70355509 CTGGACCCAAGGGGAGCTGCTGG - Intergenic
1129044576 15:72722537-72722559 CTGGATCTATGGGGAACCCTGGG - Intronic
1130902359 15:88216594-88216616 CTGGATCCAAGTGGAGCAGCTGG + Intronic
1131149470 15:90037810-90037832 CTGGATCTCGAGGGAGCAGTGGG + Intronic
1131394854 15:92078112-92078134 CTGGATCTCGAGGTAGCAGTGGG + Intronic
1132852321 16:2030347-2030369 TTGTATCTAGGGGGAGGAGTGGG - Intronic
1133398056 16:5464232-5464254 CTGGTGCTCAGGAGAGCAGTTGG + Intergenic
1136989253 16:35142159-35142181 CTAGATCTAGGATGAGCAGTAGG + Intergenic
1138000227 16:53270754-53270776 CTGAATCTTAGGTCAGCAGTGGG + Intronic
1138554432 16:57763507-57763529 CTGGCTCTGAGGGGTGCTGTGGG - Intronic
1138577754 16:57919325-57919347 CTGGATCCAAGGTCTGCAGTTGG - Intronic
1139167272 16:64582059-64582081 CTGGAACTTAGGGGAGAAGTAGG + Intergenic
1141315678 16:82960462-82960484 CTGGAGCCAAGGGGAGATGTGGG + Intronic
1143419713 17:6779232-6779254 CTGGATCACGTGGGAGCAGTGGG - Intronic
1144466545 17:15502087-15502109 CTGGCTCCAAGGGGAGGAGAGGG + Intronic
1145102572 17:20089099-20089121 CGGTGTGTAAGGGGAGCAGTAGG + Intronic
1148520754 17:48273039-48273061 CTGGATTGAAGGAGTGCAGTTGG - Intronic
1149601153 17:57893688-57893710 CTGGACCTTAGGGGAGGAGGAGG + Intronic
1156447141 18:37245493-37245515 CTACATCTAAGGGGAGAATTTGG + Intronic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1158390266 18:57039263-57039285 CTGGATGTTGGTGGAGCAGTTGG + Intergenic
1163169164 19:15518857-15518879 ATGGAACTCAGGGGACCAGTGGG + Intronic
1163643258 19:18473823-18473845 CTGGACCTGAGTGGGGCAGTGGG - Intronic
1165276122 19:34753109-34753131 CTGGATTTAAGGGAATCTGTTGG - Intergenic
1166388879 19:42397758-42397780 CTGGATCTTGGAGGAGCAGAAGG + Intergenic
1166525319 19:43507021-43507043 CTGGGTCTGAGGGAAGGAGTGGG - Intronic
1166837127 19:45674281-45674303 GTGGTTCTATGGGGAGCAGTGGG + Intronic
1166989326 19:46681743-46681765 CAGGATCTGAGGGGAGCAGATGG + Exonic
1167214306 19:48154281-48154303 TAAGATCTGAGGGGAGCAGTGGG - Intronic
1168179846 19:54654515-54654537 CTAAATGTAAGGGGAGTAGTTGG - Intronic
926580140 2:14625895-14625917 CTGGGACTAAGGTGAGCTGTAGG + Intergenic
927211665 2:20642584-20642606 CTGAGCCTGAGGGGAGCAGTCGG - Intronic
929262690 2:39883338-39883360 CTGGATCTCAGCCGAGCAGAGGG + Intergenic
929386668 2:41415946-41415968 CTGCATATAAAGGCAGCAGTGGG + Intergenic
929683196 2:44011863-44011885 CTGGACCTCAGAGGAGAAGTGGG - Intergenic
930713862 2:54574397-54574419 CAGGATCTGGAGGGAGCAGTTGG + Intronic
931462148 2:62458356-62458378 CTGGAGCCAAGGGGAGCAGAAGG - Intergenic
934296583 2:91747537-91747559 CTGGATGTCAGGGGTGCAGGGGG + Intergenic
937067259 2:119026783-119026805 CTGGATCCCAGGGAAGAAGTAGG - Intergenic
942422421 2:175821602-175821624 CTGAAACATAGGGGAGCAGTGGG - Intergenic
944015258 2:195028050-195028072 CTGGATCTCAGGCGAGAAGGAGG + Intergenic
944145505 2:196503399-196503421 CTAGATCTATGGGCAGTAGTGGG + Intronic
944289497 2:197989420-197989442 CTAGATCTGAGGGGATGAGTAGG + Intronic
947662777 2:231882391-231882413 CTGGATCCATGGGAAGAAGTGGG - Intergenic
947696859 2:232197989-232198011 CTGGAATTAAGGGTAGAAGTAGG + Intronic
947752111 2:232538609-232538631 CTGCATCTAGGGGGACCAGAGGG + Intergenic
947973443 2:234344056-234344078 CTGGAACTGAGGAGAGGAGTGGG - Intergenic
1169114387 20:3054019-3054041 CTGGAGATAAGGGGAGCTGCAGG - Intergenic
1169530889 20:6483759-6483781 CTTGATAAAAGGGCAGCAGTTGG + Intergenic
1171065240 20:22008742-22008764 CTGGATCTAGGGGAAGGAATGGG + Intergenic
1171210221 20:23310876-23310898 CTGGAGCTGAGGGGAGAAATGGG - Intergenic
1172894629 20:38291904-38291926 GTTGAACTAAGGGGAGCATTAGG - Intronic
1173607718 20:44343487-44343509 CTGGGTATAATGGGAGCAGGTGG - Exonic
1175549949 20:59810944-59810966 CACCATCTAAGGAGAGCAGTGGG + Intronic
1175845251 20:62054852-62054874 CAGGAGCTCAGGGGAGCAGCTGG - Intronic
1176087634 20:63305297-63305319 CTGGCTTCAAGGGGAGCAGCTGG + Intronic
1178763455 21:35426626-35426648 TTGGAACGAAGGAGAGCAGTGGG - Intronic
1180639921 22:17290320-17290342 CTGGAGCCAAGGGAGGCAGTGGG - Intergenic
1181051490 22:20240219-20240241 CTGGATCTCAGGTGAGCAGAGGG + Intergenic
1181855972 22:25781824-25781846 TTGGATCTCAGGTGAGCACTTGG + Exonic
950739907 3:15042115-15042137 CTGGATCTCAGGTGAGCAAGTGG - Intronic
950777954 3:15366541-15366563 CTGGAGCTAAGGGCATCATTTGG + Intergenic
951819657 3:26794078-26794100 CTGGATCTAGGGGGAGGTGAAGG - Intergenic
952918564 3:38267918-38267940 CAGGATGTCTGGGGAGCAGTGGG + Intronic
961094664 3:124144179-124144201 CAGGATCTCAGAGGAGCAGCTGG - Intronic
965768909 3:172160127-172160149 CTGAAGCCAAGGGCAGCAGTGGG + Intronic
966234714 3:177687684-177687706 CTGGATCTGAGGGCTGCATTCGG - Intergenic
967097649 3:186190371-186190393 CGGGATCTAATGGGGGCAGGTGG + Intronic
968734338 4:2287658-2287680 CTGGAGCTAAGGGGAGGAAGGGG + Intronic
968752190 4:2396023-2396045 CAGGATTTAAGGGGAGCTGATGG + Intronic
969961878 4:10952731-10952753 CAGAATGTAAGGTGAGCAGTGGG + Intergenic
971425175 4:26508810-26508832 CTGGATGTCAGGGAAGCACTTGG - Intergenic
972372710 4:38440154-38440176 CTGGCTCTAATGGGATCATTTGG + Intergenic
976461693 4:85319880-85319902 CTGGATCTAAGGGATGCAGAGGG - Intergenic
980890191 4:138806700-138806722 GAGAATCTAAGGGGAGCAGTGGG - Intergenic
984783583 4:183548098-183548120 CTGGAGGTAAGGGGAGGAGATGG - Intergenic
985906883 5:2845758-2845780 CTTTAGCTAAGGTGAGCAGTGGG - Intergenic
988490656 5:31702486-31702508 ATGGATCTAAGGGCAGAAGTCGG + Intronic
989173642 5:38498441-38498463 CTGGAGCTCAGGGGAGAGGTTGG - Intronic
989413236 5:41144176-41144198 CTGGACGTATGGGGAGAAGTAGG - Intronic
990531372 5:56676666-56676688 CTGTATCTCAGGGGAGCCCTGGG - Intergenic
994312839 5:98296214-98296236 TTGGATCTGAGGGGAGGAGTTGG + Intergenic
997921696 5:137986042-137986064 CTGGATCTATTGGGAGTATTTGG - Intronic
999422464 5:151456852-151456874 CTGGACCTAAGGAGAGCCTTCGG + Intronic
1001243464 5:170087782-170087804 CTGGAACCAAGGGGATCACTGGG - Intergenic
1002696171 5:181092614-181092636 CTGGATCTAAGAAGAGTTGTTGG - Intergenic
1006391818 6:33763119-33763141 CTGGAGGAGAGGGGAGCAGTAGG - Intergenic
1007461916 6:42025370-42025392 CTGGAGCAAAGAGGTGCAGTTGG + Intronic
1011747608 6:90421250-90421272 CTGTTTCTAATGGAAGCAGTTGG + Intergenic
1017053691 6:150419038-150419060 CTGGCATTAAGGGGTGCAGTGGG - Intergenic
1017695878 6:157015662-157015684 CTGTTTCTATTGGGAGCAGTTGG + Intronic
1020410478 7:7886697-7886719 CTGGATGTAGGGAGATCAGTTGG - Intronic
1024429729 7:49273204-49273226 CTGGAGCTGAGGGGAACAGCAGG - Intergenic
1028379145 7:90178465-90178487 CTGGATTTTAGAGAAGCAGTTGG - Intronic
1029036091 7:97523551-97523573 ATGGATCTAAAAAGAGCAGTTGG + Intergenic
1031754099 7:125615986-125616008 CTAGATCTAAAGAGAGCAATAGG - Intergenic
1034893498 7:154860239-154860261 CTTGATGGAAGGGGAGCTGTGGG - Intronic
1037151495 8:15640757-15640779 CTGGATCCAAGGGGAGATGATGG + Intronic
1046115946 8:109783306-109783328 CTGCTTATAAGGGGAGCAATGGG - Intergenic
1047088781 8:121550313-121550335 CTGGTTATAAGAGGAGCACTGGG - Intergenic
1047801625 8:128316078-128316100 CTGGAGGTAAGGAGAGCAGGAGG + Intergenic
1048420521 8:134274057-134274079 CTGGACCCAAGGAGAGTAGTTGG + Intergenic
1048519591 8:135141399-135141421 CTGGATCCAACAGGAGCAGGGGG - Intergenic
1049853696 8:144848744-144848766 CTGGGGCAAGGGGGAGCAGTGGG - Intronic
1052096533 9:24391026-24391048 CTGGCTCTAAAGAGAGCAGCGGG - Intergenic
1052339301 9:27349682-27349704 CAGTATCTTAGGGGAGCTGTTGG - Intronic
1052602804 9:30659098-30659120 CTGGCTCAAAGGGGAGCAACAGG + Intergenic
1053200245 9:36147320-36147342 CTGGACCTAGGGAGAGCAGAGGG - Intronic
1056951275 9:91042626-91042648 CTGGATTTAAGGGGAGGGGGTGG + Intergenic
1056951335 9:91042954-91042976 CTGGATTTAAGGGGAGGGGGTGG - Intergenic
1057796352 9:98160770-98160792 CTGGACATGAGGGGAGCAATGGG - Intronic
1186442379 X:9597311-9597333 CTGGGTTTAAGGAGAGCAGCAGG - Intronic
1187193961 X:17063458-17063480 CTGGCTCACAGGGGAGCAGACGG - Intronic
1189415193 X:40806506-40806528 CTGAATCAAAGGGAAGCAGTAGG - Intergenic
1192273493 X:69606968-69606990 CTAGGTCCAAGGTGAGCAGTTGG - Intergenic
1199176901 X:144799433-144799455 CTGGAACTAGGGGTAGCAGAAGG + Intergenic
1199383639 X:147199258-147199280 CAGGATGAAAGGGGAGCACTGGG - Intergenic