ID: 903780693

View in Genome Browser
Species Human (GRCh38)
Location 1:25818278-25818300
Sequence CCCAAGAGGGAGCCACCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903780693_903780698 -8 Left 903780693 1:25818278-25818300 CCATGGGGTGGCTCCCTCTTGGG 0: 1
1: 0
2: 3
3: 28
4: 211
Right 903780698 1:25818293-25818315 CTCTTGGGGCAGAGTTGAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 181
903780693_903780699 4 Left 903780693 1:25818278-25818300 CCATGGGGTGGCTCCCTCTTGGG 0: 1
1: 0
2: 3
3: 28
4: 211
Right 903780699 1:25818305-25818327 AGTTGAGCTGGAATGCTTTCAGG 0: 1
1: 0
2: 1
3: 13
4: 138
903780693_903780700 25 Left 903780693 1:25818278-25818300 CCATGGGGTGGCTCCCTCTTGGG 0: 1
1: 0
2: 3
3: 28
4: 211
Right 903780700 1:25818326-25818348 GGTACTATCTTACCTATCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903780693 Original CRISPR CCCAAGAGGGAGCCACCCCA TGG (reversed) Intronic