ID: 903780693

View in Genome Browser
Species Human (GRCh38)
Location 1:25818278-25818300
Sequence CCCAAGAGGGAGCCACCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903780693_903780699 4 Left 903780693 1:25818278-25818300 CCATGGGGTGGCTCCCTCTTGGG 0: 1
1: 0
2: 3
3: 28
4: 211
Right 903780699 1:25818305-25818327 AGTTGAGCTGGAATGCTTTCAGG 0: 1
1: 0
2: 1
3: 13
4: 138
903780693_903780700 25 Left 903780693 1:25818278-25818300 CCATGGGGTGGCTCCCTCTTGGG 0: 1
1: 0
2: 3
3: 28
4: 211
Right 903780700 1:25818326-25818348 GGTACTATCTTACCTATCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 32
903780693_903780698 -8 Left 903780693 1:25818278-25818300 CCATGGGGTGGCTCCCTCTTGGG 0: 1
1: 0
2: 3
3: 28
4: 211
Right 903780698 1:25818293-25818315 CTCTTGGGGCAGAGTTGAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903780693 Original CRISPR CCCAAGAGGGAGCCACCCCA TGG (reversed) Intronic
900139741 1:1134695-1134717 CCCATCGGGGAGCCTCCCCACGG - Intergenic
900544469 1:3220744-3220766 CCAAACAGGGAGGCAGCCCAGGG + Intronic
900565185 1:3328676-3328698 CCCAGGAAGGAGACCCCCCAGGG + Intronic
900948622 1:5845110-5845132 CCCAGGAAGGAGAGACCCCACGG + Intergenic
901055415 1:6446821-6446843 CCCAAGGCAAAGCCACCCCAGGG + Intronic
902443266 1:16445180-16445202 CCCCTGTGGGACCCACCCCAAGG + Intronic
902478957 1:16701764-16701786 CCCAAGGCAAAGCCACCCCAGGG - Intergenic
903743980 1:25574395-25574417 CCCAAGAGAGAGCAACCTCCGGG + Intergenic
903780693 1:25818278-25818300 CCCAAGAGGGAGCCACCCCATGG - Intronic
903931566 1:26865162-26865184 CACAGGAGGGAGCTGCCCCAGGG + Intergenic
904353923 1:29926406-29926428 CCCAAGAGGGACCAGCCCCCAGG - Intergenic
905386400 1:37607120-37607142 CCCAAGAGAAAGCCAACACACGG - Intergenic
905656303 1:39688223-39688245 CCCAGGAGATAGCCACCCTAGGG + Intronic
905684768 1:39900896-39900918 TCCAAGAGGGGGCCACCCCATGG - Intronic
909402802 1:75252992-75253014 CCCATGAGAGAGCCAGCCCTTGG + Intronic
915937452 1:160097857-160097879 GCAAAGAGGGACCCAACCCAGGG + Intronic
1064413033 10:15124749-15124771 CTCAAGAGGCAGACACCCAAGGG + Intronic
1067067015 10:43110052-43110074 CCCACGAGGGAGCCCACCCTTGG + Intronic
1067082424 10:43219183-43219205 CCGAAGAGGGAGCGAGGCCAAGG - Intronic
1069004034 10:63297689-63297711 TCCACCAGGTAGCCACCCCATGG + Intronic
1069571982 10:69499847-69499869 CCCAGGTGGGAATCACCCCAGGG + Intronic
1069993334 10:72328336-72328358 CCGAAGAGGTCACCACCCCAAGG - Intergenic
1070793435 10:79203188-79203210 ACCCAGACGGAGCCTCCCCAAGG + Intronic
1072223772 10:93349307-93349329 CCAAAGAAGGTGCCATCCCAGGG + Intronic
1074473701 10:113750478-113750500 GCCATGAGGGATCCACCCCCAGG + Intergenic
1075318175 10:121468615-121468637 CCAAAGTTGTAGCCACCCCAGGG - Intergenic
1075742960 10:124706841-124706863 CCCAGAAGGGCCCCACCCCAAGG - Exonic
1076707664 10:132310485-132310507 CCCAAGAGGATGCCAACCCCTGG + Intronic
1077047529 11:553005-553027 AGAAAGAAGGAGCCACCCCAGGG + Intronic
1078855917 11:15206399-15206421 CCCAGCAGGGAGCCACCCAATGG + Intronic
1079120894 11:17684147-17684169 TCCAAGAGGGAGGCATCGCATGG - Intergenic
1081699707 11:45145499-45145521 CCCCAGAGGGTACTACCCCAGGG - Intronic
1083322822 11:61857653-61857675 CCTGAGAGGCAGCTACCCCAGGG - Intronic
1083614791 11:64021049-64021071 ACCATGAGGGAGACACCCGAGGG - Intronic
1084778764 11:71395467-71395489 CCCAAGAGAGACCCAGACCATGG + Intergenic
1085400698 11:76233958-76233980 CCCAGGGTGGAGCCACCGCAGGG + Intergenic
1085511881 11:77092503-77092525 GCCAAGAGAGAGGCAGCCCAGGG - Intronic
1093061740 12:14614518-14614540 CCCAAGAGGGAGCTTCCACCTGG - Intronic
1095821831 12:46486803-46486825 CCCAAGAGGAAGTCACTGCAGGG + Intergenic
1096628961 12:52913185-52913207 CTCAAAAGTGAGCCGCCCCAAGG + Intronic
1096973239 12:55683997-55684019 CCCAACAGGTAGCCACTTCAAGG - Exonic
1099547518 12:84003854-84003876 ACCAAGAGGGATTTACCCCAGGG - Intergenic
1102597883 12:114006638-114006660 CCCAAGAGCGACCTACCACAGGG - Intergenic
1103909428 12:124344224-124344246 CCCAACAGGCAGGCGCCCCAAGG + Intronic
1104728524 12:131092622-131092644 CCCAGGTCAGAGCCACCCCAAGG - Intronic
1105039719 12:132953245-132953267 CCCAAGAGGCCGCCCCTCCAGGG + Intronic
1105071502 12:133236429-133236451 CCCCTGAGGGAGCCACCCGCAGG - Intergenic
1106446320 13:29835494-29835516 CCAAAGTGGGAGCCACCCACTGG - Intronic
1107971183 13:45643987-45644009 CCAAAGACAGAGCAACCCCAAGG - Intergenic
1109968770 13:69737670-69737692 CACTAGAGGGGGCCTCCCCATGG + Intronic
1112168152 13:96942140-96942162 CCCCAGAGGGATATACCCCAAGG - Intergenic
1113901641 13:113801285-113801307 CCCAAGAGGGGGCCATGCCTGGG - Intronic
1118725505 14:68625946-68625968 CCCAGGAGCCAGCCACACCATGG - Intronic
1118896088 14:69946817-69946839 GCCATGAGGGATGCACCCCAAGG - Intronic
1119756282 14:77122153-77122175 CCAAAGTGGGACCTACCCCAGGG - Intronic
1119857593 14:77912564-77912586 CTCAGGAGGGAGTCACTCCAGGG - Intronic
1120227168 14:81803753-81803775 CCTAAAAGGGAGCCACCCAAGGG - Intergenic
1121114133 14:91331684-91331706 CCCAACAGGGAGCTGCCCCAAGG - Intronic
1121315592 14:92959291-92959313 CCCAGGAAGGAGCCACCAGACGG + Intronic
1121626154 14:95386756-95386778 CACAGGAGGGAGCAGCCCCAGGG - Intergenic
1123472490 15:20565484-20565506 CCCAAGAGGCAACAATCCCAGGG - Intergenic
1123645514 15:22434869-22434891 CCCAAGAGGCAACAATCCCAGGG + Intergenic
1123666766 15:22614436-22614458 CCCAAGAGGCAACAACCCCAGGG + Intergenic
1123732795 15:23160475-23160497 CCCAAGAGGCAACAATCCCAGGG - Intergenic
1123750929 15:23357855-23357877 CCCAAGAGGCAACAATCCCAGGG - Intronic
1124283300 15:28381771-28381793 CCCAAGAGGCAACAATCCCAGGG - Intronic
1124299399 15:28529842-28529864 CCCAAGAGGCAACAATCCCAGGG + Intronic
1124320606 15:28709009-28709031 CCCAAGAGGCAACAACCCCAGGG + Intronic
1124481887 15:30086340-30086362 CCCAAGAGGCAACAACCCCAGGG - Intronic
1124488343 15:30138438-30138460 CCCAAGAGGCAACAACCCCAGGG - Intronic
1124521705 15:30410861-30410883 CCCAAGAGGCAACAACCCCAGGG + Intronic
1124536959 15:30555358-30555380 CCCAAGAGGCAACAACCCCAGGG - Intronic
1124543433 15:30607412-30607434 CCCAAGAGGCAACAACCCCAGGG - Intronic
1124563390 15:30794863-30794885 CCCGAGAGGCAACAACCCCAGGG - Intergenic
1124755184 15:32399882-32399904 CCCAAGAGGCAACAACCCCAGGG + Intronic
1124761692 15:32452233-32452255 CCCAAGAGGCAACAACCCCAGGG + Intronic
1124776936 15:32596835-32596857 CCCAAGAGGCAACAACCCCAGGG - Intronic
1124959892 15:34386367-34386389 CCCAAGAGGCAACAACCCCAGGG + Intronic
1124976519 15:34532588-34532610 CCCAAGAGGCAACAACCCCAGGG + Intronic
1125734089 15:41911685-41911707 CCCACCCTGGAGCCACCCCAAGG + Intronic
1127775567 15:62261878-62261900 CCCAAGAGGCAACAATCCCAAGG + Intergenic
1128227798 15:66014399-66014421 CCTAGGAAGGAGCCACCCTAAGG - Intronic
1128259637 15:66223911-66223933 CCCAACACTCAGCCACCCCAAGG - Intronic
1128383755 15:67132513-67132535 CCCAAGAGGCAGGGACTCCAAGG + Intronic
1129159232 15:73738001-73738023 TCCAACTGGGAGCCACCCCTGGG - Exonic
1129329054 15:74817445-74817467 GCCAAGAGGGAGGCAGCACAGGG - Intronic
1130533467 15:84765900-84765922 CACAATAGGGACCCACCCCTTGG - Intronic
1130573954 15:85073992-85074014 CTCCAGAGGGAGCCAACCTAAGG - Intronic
1130811816 15:87387034-87387056 TTCATGAGGGAGCCACCCCCAGG + Intergenic
1130993100 15:88888454-88888476 CAAAAGAGGTAGCCAACCCATGG + Intronic
1132433486 15:101778839-101778861 CCCGAGAGGCAACAACCCCAGGG + Intergenic
1132988496 16:2780447-2780469 CCCCAGAGGGTGACACCACAGGG + Intergenic
1133286274 16:4692263-4692285 CCAAAGAGGGCCCCACCCCTAGG - Intergenic
1134100703 16:11449567-11449589 GCCAACAGGGAACCATCCCATGG - Intronic
1138593031 16:58012991-58013013 CCTCAGAGGGAACCAGCCCAGGG - Intronic
1140457843 16:75115071-75115093 CCCCAGAGGCAGGCAGCCCACGG + Intronic
1143463500 17:7119537-7119559 CACCAAAGGGAGCCCCCCCAAGG - Intergenic
1148018675 17:44539716-44539738 CCAAAGAGGGAGGCACCCAGAGG - Intergenic
1148831721 17:50437100-50437122 CCCAAGAGGATGCAGCCCCATGG + Intronic
1151199120 17:72454752-72454774 CCCAAGAGGTAGGGACCCCTGGG - Intergenic
1151244589 17:72784602-72784624 CCCATTAGGGATCCACCCCCAGG - Intronic
1151551480 17:74824907-74824929 CCCAAGAGGAAGCCATCACCTGG + Intronic
1152545938 17:81000163-81000185 CCACAGAGGGAGCCACGCCTAGG - Intronic
1152855590 17:82663383-82663405 CCCAAGAGGGAGGCAGCCCCAGG + Intronic
1157074775 18:44453531-44453553 CCCATGAGGGAGCTTCGCCAAGG - Intergenic
1160428434 18:78794219-78794241 TCCCAGATGGGGCCACCCCAGGG + Intergenic
1160677399 19:398790-398812 CCCAGGACGGCCCCACCCCAGGG - Intergenic
1163132759 19:15286038-15286060 CCAGGGAGGGAGCCACCTCAAGG + Intronic
1164096000 19:22010551-22010573 CCCAAGAGGGCTCCAGGCCAGGG + Intronic
1164115500 19:22215406-22215428 CCCAAGAGGGCTCCAGGCCAGGG + Intergenic
1164199176 19:23002783-23002805 CCCAAGAGGGCTCCAGGCCAGGG + Intronic
1165068264 19:33241264-33241286 CCCAGGAGGGACCAGCCCCAAGG - Intergenic
1168635357 19:57991952-57991974 TCTAAGAAGGTGCCACCCCAGGG - Intronic
1202712998 1_KI270714v1_random:27671-27693 CCCAAGGCAAAGCCACCCCAGGG - Intergenic
925160136 2:1677749-1677771 GCCATGAGGGAACCACACCAAGG + Intronic
925383763 2:3447574-3447596 CCCATGAGGGATCCACCCCCAGG + Intronic
925761809 2:7192043-7192065 TCCAAGAGAGAGCAACCACAGGG - Intergenic
926630533 2:15131953-15131975 CCAACGAGGGATCCACCCCGTGG + Intergenic
927706865 2:25301791-25301813 CCCAAGGAGGGGCCAACCCAGGG + Intronic
930150156 2:48051175-48051197 CTCTAGACAGAGCCACCCCAAGG + Intergenic
934503969 2:94877827-94877849 CCCAAGAGGGCTCCTCCCCGAGG - Intergenic
936239350 2:110773618-110773640 CCCAAGAGGGAGCCAAGGCCAGG - Intronic
937114755 2:119397253-119397275 CCTCAGAGGGAGCCAGCCCCGGG - Intergenic
937987595 2:127645450-127645472 CCCAGCCCGGAGCCACCCCAGGG + Intronic
938198379 2:129352825-129352847 CCCAGGAGGCAGCCAAGCCAAGG + Intergenic
939838588 2:147158829-147158851 CCCAAGAGGGTGCAACCCCAGGG - Intergenic
940753387 2:157653905-157653927 GCCATGAGGGCTCCACCCCATGG - Intergenic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
947727522 2:232409456-232409478 CCCCTCAGGGGGCCACCCCACGG - Intronic
949046279 2:241873929-241873951 CCCAAGAGGGAGCTCTCCCCAGG - Intergenic
1174201505 20:48809459-48809481 CCCAGGAGGCAGCTGCCCCAGGG + Intronic
1174368911 20:50073256-50073278 CCCAAGATGAAGCCAGCCCCAGG + Intergenic
1175215693 20:57390792-57390814 CCCCGGAGGGAGCTACACCACGG - Intergenic
1175989948 20:62783625-62783647 CCCAGGAGGCAGCCTGCCCAGGG - Intergenic
1178640271 21:34339889-34339911 CCAAAGAGGGAGCCAACAGAGGG - Intergenic
1179591467 21:42412142-42412164 CCCAGGAAGCAGCCTCCCCAGGG + Intronic
1179731828 21:43372525-43372547 CCCACCAGGGAACCACACCAGGG + Intergenic
1180132833 21:45837549-45837571 CCCAAGAGGCAGACAACCCAGGG - Intronic
1181339405 22:22166104-22166126 CCCAGCTGGGAGCCACCCCCTGG + Intergenic
1182347034 22:29673603-29673625 GCCAAGGAGGAGCCTCCCCACGG - Intronic
1184829695 22:46976720-46976742 ACCAAGAGAGAGCTTCCCCAAGG - Intronic
1185162255 22:49237030-49237052 CCCCAGAGGCAGTCACCACAGGG + Intergenic
1185250469 22:49799199-49799221 CCCAAGAGGCATCCACGTCAGGG + Intronic
1185359912 22:50399841-50399863 CAGCAGAGGGCGCCACCCCAGGG + Intronic
949888632 3:8715373-8715395 CCCAAGAGGAATCCAGCACATGG + Intronic
951247596 3:20359157-20359179 CCTAAGTGGGAGGCACCCCCCGG - Intergenic
952449817 3:33421178-33421200 CCCAAAATGGAGCCACCAGAGGG - Intronic
953547633 3:43875368-43875390 CCCAAGAGGCAGGCACTCCCAGG + Intergenic
956901839 3:73724851-73724873 GCCATGAGGGATCCACTCCAAGG + Intergenic
957718938 3:83969521-83969543 CTCCAGAGGGGGACACCCCAGGG + Intergenic
962535803 3:136327870-136327892 CCCAAGAGGGAGACTTACCAAGG - Intronic
962755455 3:138462373-138462395 CCCAAGTGGGATACACCCCAAGG - Intronic
963149290 3:142027875-142027897 CCCAAGAGGCAGACACCAAATGG + Intronic
963332205 3:143927120-143927142 GCCTAGAGGGACCCATCCCAAGG - Intergenic
964480999 3:157138338-157138360 GCCATGAGGGATCCACCCCATGG + Intergenic
966152907 3:176884383-176884405 CCCATGAGGCAGAGACCCCAGGG - Intergenic
966800728 3:183761545-183761567 CCCAATTGGGAGTCACCCTAAGG + Exonic
968481279 4:834181-834203 CCCAGGAGGGAGCCAGTCCGTGG - Intergenic
968491929 4:894502-894524 CCAAGGAAGGAGCCACCCCTCGG - Intronic
968811544 4:2801636-2801658 CCCAGGAGGAAGCCAGCGCAAGG + Intronic
968984824 4:3869416-3869438 CCCAAGAGGGAGCCTCGCCAAGG - Intergenic
969310682 4:6351542-6351564 CCCATGGGGGAGCCATCACAGGG + Intronic
969372561 4:6743122-6743144 CCCTCCACGGAGCCACCCCAGGG + Intergenic
969686019 4:8674708-8674730 CCCCACAGGGCCCCACCCCACGG - Intergenic
979519798 4:121653052-121653074 CTAAAGAGGCAGCCACCTCAGGG + Intergenic
981292152 4:143088738-143088760 TGCAAGAGGTAGTCACCCCAAGG - Intergenic
985508904 5:300688-300710 ACCAAGAGAGAACCACCACAAGG - Intronic
985627732 5:998579-998601 CCCGTGAGGGTGCCACTCCATGG + Intergenic
985739220 5:1605228-1605250 ACCAAGAGAGAACCACCACAAGG + Intergenic
986576914 5:9222042-9222064 CCCCAGGGGGGGCCACCCCTTGG - Intronic
989750921 5:44892579-44892601 TCCAAGTGGGATTCACCCCATGG - Intergenic
992012757 5:72545686-72545708 ACCAAGAGGGATTCATCCCAGGG - Intergenic
993245979 5:85453613-85453635 CCCGAGAGGGAAACACCACACGG - Intergenic
996679187 5:126212149-126212171 CCTAAGAGGGTCCCTCCCCAGGG - Intergenic
996738594 5:126778414-126778436 CCAAAGCGGGACCCACCCCCAGG - Intronic
998296405 5:140973701-140973723 CCCAGGAGTGAGCCATCACATGG + Intronic
998411736 5:141916337-141916359 CCCAAGAGTCAGCCAGCACAGGG + Intergenic
998703717 5:144734416-144734438 GCCATGAGGGATCCACCCCTAGG - Intergenic
1001513466 5:172339135-172339157 CCCAAAACGGAGCCACCTCAGGG - Exonic
1001559864 5:172661940-172661962 ACCAAGGGGAAGCAACCCCAGGG + Intronic
1001994545 5:176145452-176145474 TCCCAGAAGGAGCCAGCCCAGGG + Intergenic
1003367090 6:5485044-5485066 CCAAAGAGGGAGAAAGCCCATGG + Intronic
1004159896 6:13204151-13204173 ACCAAGCAGGAGCCAGCCCATGG + Intronic
1004487677 6:16082623-16082645 CCCAAGAGGCAGCCACTCCCAGG + Intergenic
1004753099 6:18583731-18583753 GAGAAGAGGGAGCCAGCCCAGGG + Intergenic
1005928737 6:30465312-30465334 CCTGAGTGGGAGCTACCCCAAGG - Intergenic
1008663181 6:53690740-53690762 CCCAAGAGACAGCCACCCACTGG - Intergenic
1009015145 6:57891277-57891299 CCTTAGAGGGAGCCAACCCCGGG - Intergenic
1011282434 6:85690268-85690290 CACAAGAGGGAGGCACCTGAAGG - Intergenic
1012578728 6:100836577-100836599 ACCAAGAGGGATTCATCCCAGGG - Intronic
1015662323 6:135589329-135589351 ACCACATGGGAGCCACCCCAAGG + Intergenic
1016823565 6:148367806-148367828 CCCAGGAGGGGGACACCCCTCGG + Intronic
1017637277 6:156455916-156455938 CTCCAGAGGGAACCAGCCCATGG - Intergenic
1019526969 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG + Intronic
1019774115 7:2902118-2902140 TCCAGGAGTGAGCCACCGCACGG - Intergenic
1022425622 7:30266085-30266107 CCAAACAGCTAGCCACCCCATGG - Intergenic
1024974494 7:55100692-55100714 CCCAGGAGTGGCCCACCCCAAGG - Intronic
1028055362 7:86234013-86234035 CCAAAGAAGGAGCCACAGCATGG + Intergenic
1029515385 7:101020242-101020264 CCCAAGAGGCCCCCATCCCAGGG + Intronic
1033421467 7:141208238-141208260 CACAGGAAGGAGCCACCCCTGGG + Intronic
1034886279 7:154801513-154801535 CCCTAGAGGCTGTCACCCCACGG - Intronic
1035446100 7:158944227-158944249 CCCAACACTGAGCCACCACAAGG - Intronic
1038024970 8:23580157-23580179 CCTTAAAGGCAGCCACCCCAAGG - Intergenic
1041117138 8:54550826-54550848 CCTGAGAGGAAGCAACCCCAGGG + Intergenic
1041435231 8:57831863-57831885 CGGAAGACAGAGCCACCCCAGGG + Intergenic
1043006901 8:74831105-74831127 CCCCACAGGGAGCCAGCCAAAGG + Intronic
1043483307 8:80674509-80674531 GCCAAGAGGGATCTAACCCAAGG + Intronic
1048017547 8:130511177-130511199 CCCAGGAGGTAGCCATCCCTGGG - Intergenic
1048141585 8:131800079-131800101 CCAAACAGGGATCTACCCCATGG + Intergenic
1049373797 8:142279744-142279766 CCCAAGAGGGAGACCCTCCGAGG - Intronic
1049388257 8:142355024-142355046 CCCAAGAGGGACCCCCAGCAAGG + Intronic
1049619851 8:143593147-143593169 CTCAAGGGGGAGGCAGCCCAGGG + Intronic
1049967377 9:791820-791842 GCCAGGAGGGAGGCACCCCGTGG - Intergenic
1051784522 9:20727810-20727832 CCCAAGAGGGATGCATCCCTAGG - Intronic
1052857245 9:33415094-33415116 CCCAGGAGGCAGCCTGCCCAAGG - Intergenic
1053549035 9:39055641-39055663 GCTAAGAGGGAGCAACCTCAGGG + Intergenic
1053813161 9:41875725-41875747 GCTAAGAGGGAGCAACCTCAGGG + Intergenic
1054617434 9:67311714-67311736 GCTAAGAGGGAGCAACCTCAGGG - Intergenic
1056803335 9:89709143-89709165 CCCAAGAGGGAGCATCCCAAGGG + Intergenic
1057891811 9:98875312-98875334 CCTCAGAGGAAGCCATCCCAGGG - Intergenic
1059040235 9:110806884-110806906 GCCCAGAGGTAGCCATCCCACGG - Intergenic
1059409322 9:114122236-114122258 TCCAACAAGGAGCCACCCCTAGG - Intergenic
1061064113 9:128266929-128266951 CCCAAGAGGCAACAACCCCAGGG + Intronic
1061796222 9:133087287-133087309 GCCGAGAGGGTGCAACCCCAGGG + Intronic
1062052393 9:134454396-134454418 CCCAGGAGGCAGCCACCACCAGG + Intergenic
1062162825 9:135089111-135089133 CTTAGGAGGGAGCCACACCACGG - Intronic
1185481416 X:449253-449275 CCCAGGAGGGATACTCCCCACGG - Intergenic
1189416234 X:40816754-40816776 CCCCAAAGGGGGACACCCCAGGG - Intergenic
1191592798 X:62906394-62906416 CCCAACTGGGAGGCACCCCCCGG - Intergenic
1191604327 X:63044694-63044716 TCCAGGAGGGAGCCATTCCAAGG - Intergenic
1191604389 X:63044964-63044986 TCCAGGAGGGAGCCACTCCATGG - Intergenic
1196562939 X:117172921-117172943 CAGAAGAGGGAACCAGCCCAGGG + Intergenic
1198586531 X:138128366-138128388 GACAAGAGGCAGCCCCCCCAAGG - Intergenic
1199558529 X:149136731-149136753 CCCAACAGGGAGAGAGCCCAGGG - Intergenic
1200697811 Y:6376546-6376568 CTGAAGAGAGAGCCACCCCTGGG + Intergenic
1200700083 Y:6394727-6394749 CCTAGGAGGGAGCAACACCAAGG + Intergenic
1200708677 Y:6464752-6464774 CCTAAGAGAGAGCAACCCCAGGG + Intergenic
1201025435 Y:9699957-9699979 CCTAAGAGAGAGCAACCCCAGGG - Intergenic
1201034028 Y:9769971-9769993 CCTAGGAGGGAGCAACACCAAGG - Intergenic
1201036301 Y:9788153-9788175 CTGAAGAGAGAGCCACCCCTGGG - Intergenic
1202148387 Y:21823145-21823167 CCCAGGAGAGAGCAACCCCAAGG - Intergenic
1202175612 Y:22096381-22096403 CCTAGGAGAGAGCAACCCCAAGG + Intergenic
1202215749 Y:22490002-22490024 CCTAGGAGAGAGCAACCCCAAGG - Intergenic