ID: 903781156

View in Genome Browser
Species Human (GRCh38)
Location 1:25820674-25820696
Sequence CGGTGCTGCCGGCGAACCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903781145_903781156 17 Left 903781145 1:25820634-25820656 CCTCCGGAGGGCTGCGGGGCGCA 0: 1
1: 0
2: 1
3: 22
4: 148
Right 903781156 1:25820674-25820696 CGGTGCTGCCGGCGAACCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45
903781146_903781156 14 Left 903781146 1:25820637-25820659 CCGGAGGGCTGCGGGGCGCAGAG 0: 1
1: 0
2: 4
3: 30
4: 282
Right 903781156 1:25820674-25820696 CGGTGCTGCCGGCGAACCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903781156 Original CRISPR CGGTGCTGCCGGCGAACCGG GGG Intronic