ID: 903781156

View in Genome Browser
Species Human (GRCh38)
Location 1:25820674-25820696
Sequence CGGTGCTGCCGGCGAACCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
903781146_903781156 14 Left 903781146 1:25820637-25820659 CCGGAGGGCTGCGGGGCGCAGAG 0: 1
1: 0
2: 4
3: 30
4: 282
Right 903781156 1:25820674-25820696 CGGTGCTGCCGGCGAACCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45
903781145_903781156 17 Left 903781145 1:25820634-25820656 CCTCCGGAGGGCTGCGGGGCGCA 0: 1
1: 0
2: 1
3: 22
4: 148
Right 903781156 1:25820674-25820696 CGGTGCTGCCGGCGAACCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903781156 Original CRISPR CGGTGCTGCCGGCGAACCGG GGG Intronic
900577504 1:3390576-3390598 CGGTGCTGCCTGGCCACCGGCGG - Intronic
903215425 1:21841089-21841111 CGGTGCTGCAGGTGAAGCCGGGG - Exonic
903781156 1:25820674-25820696 CGGTGCTGCCGGCGAACCGGGGG + Intronic
905027333 1:34859717-34859739 CCGTGCTCCCGGCGAGCGGGCGG - Exonic
915457153 1:156048497-156048519 CAGTGCTGCCCGGGAACAGGTGG - Exonic
1075112371 10:119597428-119597450 CTGTGCTGGCGGGGACCCGGAGG + Intergenic
1083795527 11:65014481-65014503 CGGTCCTGCAGGCGCAGCGGCGG + Intronic
1096482473 12:51951788-51951810 CGCCGCTGCCGGCGAGCAGGAGG - Exonic
1100540027 12:95548818-95548840 CGTCGCGGCCGCCGAACCGGGGG - Intronic
1101781883 12:107844720-107844742 CGGGGCTGCCTGAGAACCCGCGG + Intergenic
1101970458 12:109309141-109309163 CGCCGCTGCCGGCGCTCCGGGGG + Exonic
1124244467 15:28057768-28057790 CGCTGCTGCAGGGGAACAGGTGG + Intronic
1124696803 15:31870466-31870488 CGGTGCTGCCGGCGGGCGGCGGG - Intronic
1132495659 16:262101-262123 CGGTGCTGCCGGAGTAGAGGTGG - Exonic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1134490834 16:14694251-14694273 CGGTGCTGCAGGGCCACCGGAGG + Exonic
1134496215 16:14733369-14733391 CGGTGCTGCAGGGCCACCGGAGG + Intronic
1136154585 16:28374461-28374483 CGGTGCTGCCGGGCCGCCGGAGG - Intergenic
1136208506 16:28740803-28740825 CGGTGCTGCCGGGCCGCCGGAGG + Intergenic
1136264588 16:29107467-29107489 CGGTGCTGCCGGGCCACCAGAGG + Intergenic
1138016618 16:53434461-53434483 CGGTGCGGGCGGCGGACGGGCGG + Exonic
1142271938 16:89094244-89094266 CGGTGATACCGTCGAGCCGGCGG + Intronic
1148271756 17:46267000-46267022 CGGCGCGGGCGGCGAGCCGGGGG - Intergenic
1152552107 17:81035049-81035071 CGGTGATGCGGGCGCAACGGGGG + Intergenic
1155915924 18:31557110-31557132 CGGTTCTGCAGGTGAACCAGAGG - Intergenic
1162033092 19:7925725-7925747 TGGTGGTGGCGGCGATCCGGCGG - Intronic
1168590860 19:57633359-57633381 GGGAGCTGCGGGCGACCCGGGGG - Exonic
937325613 2:120988253-120988275 CGGGGCTGCTGCCGAACCCGCGG + Exonic
1175978649 20:62726097-62726119 TGGAGCTGCCGGTGACCCGGTGG - Intronic
1179654629 21:42837643-42837665 AGGTGCTGCCGGCCAGCGGGAGG - Intergenic
1181079698 22:20405730-20405752 CCGCGCTGCCGGCGCACCTGGGG - Exonic
953099452 3:39810258-39810280 CTGTGCTGCGGGCGCACCGGCGG + Intronic
985506718 5:285685-285707 CCGTGCAGCTGGCGACCCGGGGG + Intronic
997120050 5:131164764-131164786 CGAGGCAGCCGGGGAACCGGCGG + Intronic
1002083318 5:176750412-176750434 CAGTGCTCCCGGCGAACCCACGG - Intergenic
1007434587 6:41799842-41799864 AGGTGCAGCCGGAGAACCTGAGG + Exonic
1013317069 6:108953301-108953323 CGGTGCTGGCCGCCAACCCGGGG + Exonic
1017717197 6:157221338-157221360 CGGTGCTGTGTGCGAACCAGAGG + Intergenic
1019268072 7:130036-130058 CGGGGCAGCCGGGGAAGCGGAGG - Intergenic
1021761294 7:23904979-23905001 CGGTGGGGCCGGCGGGCCGGCGG + Intergenic
1029735840 7:102465313-102465335 CGGGGCTCCCGGCGAGCGGGTGG - Intronic
1041201117 8:55452564-55452586 CGGTGCAGCGGGAGAACCGGAGG - Intronic
1049748769 8:144273875-144273897 CGCTGCTGCCTGCGCACCTGGGG + Intronic
1057883055 9:98807802-98807824 CGGTGCTGCGGGCGCAGCGTGGG + Exonic
1059234524 9:112750764-112750786 CCGTGCTGCCAGCGGACCCGCGG + Intergenic
1061449223 9:130659674-130659696 CGGGGCTGCCGGCGGAGTGGCGG - Intergenic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1187464408 X:19515021-19515043 CGGCGCGGCCGGCGGCCCGGAGG - Exonic